Regulon of Bcav_0107 in Clavibacter michiganensis subsp. michiganensis NCPPB 382

Properties
Regulator type:	Transcription factor
TF locus tag:	CMM_2354
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug efflux
Effector:
Regulog:	Bcav_0107 - Micrococcineae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By TF family - GntR/Others
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -21 Score: 5.6 Sequence: TTGTTCGCATAGAATGCGAACAT Locus tag: CMM_2354 Name: Bcav_0107 Funciton: Transcriptional regulator, GntR family Locus tag: CMM_2353 Name: SCO3813 Funciton: integral membrane protein
	CMM_2354	Bcav_0107	Transcriptional regulator, GntR family
	CMM_2353	SCO3813	integral membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD