Regulon of AzrR in Shewanella pealeana ATCC 700345

Properties
Regulator type:	Transcription factor
TF locus tag:	Spea_0888
Regulator family:	[Other]
Regulation mode:	repressor
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	AzrR - Shewanellaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 34 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - [Other]
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -104 Score: 5.6 Sequence: CTTTACCAAACAAAGTAAAG Locus tag: Spea_0888 Name: azrR Funciton: putative transcriptional regulator of azoreductase, AsnC family
	Spea_0888	azrR	putative transcriptional regulator of azoreductase, AsnC family
Position: -65 Score: 5.6 Sequence: CTTTACTTTGTTTGGTAAAG Locus tag: Spea_0887 Name: azr Funciton: NADPH-dependent FMN reductase Locus tag: Spea_0886 Name: SO3586 Funciton: Glyoxalase family protein
	Spea_0887	azr	NADPH-dependent FMN reductase
	Spea_0886	SO3586	Glyoxalase family protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD