Regulon of AzrR in Shewanella oneidensis MR-1

Properties
Regulator type:	Transcription factor
TF locus tag:	SO3584
Regulator family:	[Other]
Regulation mode:	repressor
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	AzrR - Shewanellaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 34 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - [Other]
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -104 Score: 6.5 Sequence: CTTTATTTAATCTTGTAAAG Locus tag: SO_3584 Name: azrR Funciton: putative transcriptional regulator of azoreductase, AsnC family
	SO_3584	azrR	putative transcriptional regulator of azoreductase, AsnC family
Position: -62 Score: 6.5 Sequence: CTTTACAAGATTAAATAAAG Locus tag: SO_3585 Name: azr Funciton: NADPH-dependent FMN reductase Locus tag: SO_3586 Name: SO3586 Funciton: Glyoxalase family protein
	SO_3585	azr	NADPH-dependent FMN reductase
	SO_3586	SO3586	Glyoxalase family protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD