Regulon of MalR2 in Clostridium beijerincki NCIMB 8052

Properties
Regulator type:	Transcription factor
TF locus tag:	Cbei_0234
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Regulog:	MalR2 - Clostridia-1
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Regulated operons
	Locus Tag	Name	Function
Position: -139 Score: 6 Sequence: TTTCGCAATCGTTTGCGAAA Locus tag: Cbei_0230 Name: malE Funciton: Maltose/maltodextrin ABC transporter, substrate-binding component Locus tag: Cbei_0231 Name: malF Funciton: Maltose/maltodextrin ABC transporter, permease protein 1 Locus tag: Cbei_0232 Name: malG Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
	Cbei_0230	malE	Maltose/maltodextrin ABC transporter, substrate-binding component
	Cbei_0231	malF	Maltose/maltodextrin ABC transporter, permease protein 1
	Cbei_0232	malG	Maltose/maltodextrin ABC transporter, permease protein 2
Position: -89 Score: 6.4 Sequence: TTGCGCAAGCGATTGCTTTA Locus tag: Cbei_0233 Name: malM Funciton: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
	Cbei_0233	malM	4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
Position: -177 Score: 5.9 Sequence: TTGTGCAACCGATTGCAATA Position: -39 Score: 5.6 Sequence: TTTTGCAACCGATTGCGCTA Locus tag: Cbei_0664 Name: amyE Funciton: Alpha-amylase (EC 3.2.1.1)
	Cbei_0664	amyE	Alpha-amylase (EC 3.2.1.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD