Regulon of ScrR in Serratia proteamaculans 568

Properties
Regulator type:	Transcription factor
TF locus tag:	Spro_4207
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose-6-phosphate
Regulog:	ScrR - Enterobacteriales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - Sucrose-6-phosphate
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -62 Score: 5.9 Sequence: TTGCTAAACCGGTTCTTCTA Locus tag: Spro_4203 Name: scrK Funciton: Fructokinase (EC 2.7.1.4)
	Spro_4203	scrK	Fructokinase (EC 2.7.1.4)
Position: -123 Score: 5.4 Sequence: TAGCTGAATCGGGTTAGCAA Position: -63 Score: 6 Sequence: CTGAAAAACCGGTTTAGCAA Locus tag: Spro_4204 Name: scrY Funciton: Putative sucrose porin Locus tag: Spro_4205 Name: scrA Funciton: PTS system sucrose-specific EIIBC component, EC=2.7.1.69 Locus tag: Spro_4206 Name: scrB Funciton: Sucrose-6-phosphate hydrolase (sucrase) EC=3.2.1.26 Locus tag: Spro_4207 Name: scrR Funciton: Sucrose operon repressor ScrR, LacI family
	Spro_4204	scrY	Putative sucrose porin
	Spro_4205	scrA	PTS system sucrose-specific EIIBC component, EC=2.7.1.69
	Spro_4206	scrB	Sucrose-6-phosphate hydrolase (sucrase) EC=3.2.1.26
	Spro_4207	scrR	Sucrose operon repressor ScrR, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD