Regulon of ScrR in Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Properties
Regulator type:	Transcription factor
TF locus tag:	KPN_00512
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose-6-phosphate
Regulog:	ScrR - Enterobacteriales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - Sucrose-6-phosphate
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -119 Score: 5.9 Sequence: TTCTTAAACCGGTTTAGCAA Position: -61 Score: 6.1 Sequence: CAACTAAACCGGTTTAGCAA Locus tag: KPN_00515 Name: scrY Funciton: Putative sucrose porin Locus tag: KPN_00514 Name: scrA Funciton: PTS system sucrose-specific EIIBC component, EC=2.7.1.69 Locus tag: KPN_00513 Name: scrB Funciton: Sucrose-6-phosphate hydrolase (sucrase) EC=3.2.1.26 Locus tag: KPN_00512 Name: scrR Funciton: Sucrose operon repressor ScrR, LacI family
	KPN_00515	scrY	Putative sucrose porin
	KPN_00514	scrA	PTS system sucrose-specific EIIBC component, EC=2.7.1.69
	KPN_00513	scrB	Sucrose-6-phosphate hydrolase (sucrase) EC=3.2.1.26
	KPN_00512	scrR	Sucrose operon repressor ScrR, LacI family
Position: -45 Score: 5.8 Sequence: GAGCTAAACCGGTTTAATAA Locus tag: KPN_00516 Name: scrK Funciton: Fructokinase (EC 2.7.1.4)
	KPN_00516	scrK	Fructokinase (EC 2.7.1.4)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD