Regulon of ScrR in Erwinia amylovora ATCC 49946

Properties
Regulator type:	Transcription factor
TF locus tag:	EAM_1594
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose-6-phosphate
Regulog:	ScrR - Enterobacteriales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - Sucrose-6-phosphate
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -51 Score: 5.7 Sequence: AGGCTAAACCCGTTTAGCTT Locus tag: EAM_1598 Name: scrK Funciton: Fructokinase (EC 2.7.1.4)
	EAM_1598	scrK	Fructokinase (EC 2.7.1.4)
Position: -52 Score: 5.2 Sequence: CTGTCGAACCGGTTTAGCAT Locus tag: EAM_1597 Name: scrY Funciton: Putative sucrose porin Locus tag: EAM_1596 Name: scrA Funciton: PTS system sucrose-specific EIIBC component, EC=2.7.1.69 Locus tag: EAM_1595 Name: scrB Funciton: Sucrose-6-phosphate hydrolase (sucrase) EC=3.2.1.26 Locus tag: EAM_1594 Name: scrR Funciton: Sucrose operon repressor ScrR, LacI family
	EAM_1597	scrY	Putative sucrose porin
	EAM_1596	scrA	PTS system sucrose-specific EIIBC component, EC=2.7.1.69
	EAM_1595	scrB	Sucrose-6-phosphate hydrolase (sucrase) EC=3.2.1.26
	EAM_1594	scrR	Sucrose operon repressor ScrR, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD