Regulon of ScrR in Citrobacter koseri ATCC BAA-895

Properties
Regulator type:	Transcription factor
TF locus tag:	CKO_02943
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose-6-phosphate
Regulog:	ScrR - Enterobacteriales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - Sucrose-6-phosphate
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -119 Score: 6.5 Sequence: TTGTTAAACCGGTTTAGCAA Position: -59 Score: 5.5 Sequence: TGCCTAAACCGGTTTAGCTG Locus tag: CKO_02946 Name: scrY Funciton: Putative sucrose porin Locus tag: CKO_02945 Name: scrA Funciton: PTS system sucrose-specific EIIBC component, EC=2.7.1.69 Locus tag: CKO_02944 Name: scrB Funciton: Sucrose-6-phosphate hydrolase (sucrase) EC=3.2.1.26 Locus tag: CKO_02943 Name: scrR Funciton: Sucrose operon repressor ScrR, LacI family
	CKO_02946	scrY	Putative sucrose porin
	CKO_02945	scrA	PTS system sucrose-specific EIIBC component, EC=2.7.1.69
	CKO_02944	scrB	Sucrose-6-phosphate hydrolase (sucrase) EC=3.2.1.26
	CKO_02943	scrR	Sucrose operon repressor ScrR, LacI family
Position: -40 Score: 5.7 Sequence: TAGCTAAATCGGTTTAACGT Locus tag: CKO_02947 Name: scrK Funciton: Fructokinase (EC 2.7.1.4)
	CKO_02947	scrK	Fructokinase (EC 2.7.1.4)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD