Regulon of Jann_1459 in Rhodobacter sphaeroides 2.4.1

Properties
Regulator type:	Transcription factor
TF locus tag:	RSP_1243
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	Jann_1459 - Rhodobacterales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -109 Score: 4.3 Sequence: CGTTGTAAACGTTTGTCGCG Position: -77 Score: 5.7 Sequence: CTCTGCAAACGATTACATCA Locus tag: RSP_1244 Name: COG1082 Funciton: Sugar phosphate isomerases/epimerases Locus tag: RSP_1245 Name: COG0673 Funciton: Predicted dehydrogenases and related proteins Locus tag: RSP_1247 Name: SMb20718 Funciton: Sugar ABC transport system, ATP-binding protein Locus tag: RSP_6150 Name: SMb20719 Funciton: SugarABC transport system, inner membrane protein Locus tag: RSP_1249 Name: SMb20720 Funciton: Sugar ABC transport system, substrate-binding protein
	RSP_1244	COG1082	Sugar phosphate isomerases/epimerases
	RSP_1245	COG0673	Predicted dehydrogenases and related proteins
	RSP_1247	SMb20718	Sugar ABC transport system, ATP-binding protein
	RSP_6150	SMb20719	SugarABC transport system, inner membrane protein
	RSP_1249	SMb20720	Sugar ABC transport system, substrate-binding protein
Position: -93 Score: 5.7 Sequence: TGATGTAATCGTTTGCAGAG Position: -61 Score: 4.3 Sequence: CGCGACAAACGTTTACAACG Locus tag: RSP_1243 Name: Jann_1459 Funciton: Transcriptional regulator, LacI family
	RSP_1243	Jann_1459	Transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD