Regulon of Jann_1459 in Oceanicola batsensis HTCC2597

Properties
Regulator type:	Transcription factor
TF locus tag:	OB2597_08889
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	Jann_1459 - Rhodobacterales
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -84 Score: 5.1 Sequence: CCTTGAAATCGATTACATCC Locus tag: OB2597_08889 Name: Jann_1459 Funciton: Transcriptional regulator, LacI family
	OB2597_08889	Jann_1459	Transcriptional regulator, LacI family
Position: -50 Score: 5.1 Sequence: GGATGTAATCGATTTCAAGG Locus tag: OB2597_08884 Name: COG1082 Funciton: Sugar phosphate isomerases/epimerases Locus tag: OB2597_08879 Name: COG0673 Funciton: Predicted dehydrogenases and related proteins Locus tag: OB2597_08874 Name: null Funciton: Putative isomerase/epimerase Locus tag: OB2597_08869 Name: SMb20718 Funciton: Sugar ABC transport system, ATP-binding protein Locus tag: OB2597_08864 Name: SMb20719 Funciton: SugarABC transport system, inner membrane protein Locus tag: OB2597_08859 Name: SMb20719 Funciton: SugarABC transport system, inner membrane protein Locus tag: OB2597_08854 Name: SMb20720 Funciton: Sugar ABC transport system, substrate-binding protein
	OB2597_08884	COG1082	Sugar phosphate isomerases/epimerases
	OB2597_08879	COG0673	Predicted dehydrogenases and related proteins
	OB2597_08874		Putative isomerase/epimerase
	OB2597_08869	SMb20718	Sugar ABC transport system, ATP-binding protein
	OB2597_08864	SMb20719	SugarABC transport system, inner membrane protein
	OB2597_08859	SMb20719	SugarABC transport system, inner membrane protein
	OB2597_08854	SMb20720	Sugar ABC transport system, substrate-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD