Regulon of Jann_1459 in Jannaschia sp. CCS1

Properties
Regulator type:	Transcription factor
TF locus tag:	Jann_1459
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	Jann_1459 - Rhodobacterales
Statistics of regulated genes:
- Genes	10
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -74 Score: 5.4 Sequence: CTCTGAAATCGATTACATAC Locus tag: Jann_1459 Name: Jann_1459 Funciton: Transcriptional regulator, LacI family
	Jann_1459	Jann_1459	Transcriptional regulator, LacI family
Position: -92 Score: 5.4 Sequence: GTATGTAATCGATTTCAGAG Locus tag: Jann_1460 Name: null Funciton: short-chain dehydrogenase/reductase SDR Locus tag: Jann_1461 Name: Jann_1461 Funciton: oxidoreductase-like Locus tag: Jann_1462 Name: COG1082 Funciton: Sugar phosphate isomerases/epimerases Locus tag: Jann_1463 Name: SMb20720 Funciton: Sugar ABC transport system, substrate-binding protein Locus tag: Jann_1464 Name: SMb20718 Funciton: Sugar ABC transport system, ATP-binding protein Locus tag: Jann_1465 Name: SMb20719 Funciton: SugarABC transport system, inner membrane protein Locus tag: Jann_1466 Name: SMb20719 Funciton: SugarABC transport system, inner membrane protein Locus tag: Jann_1467 Name: COG0673 Funciton: Predicted dehydrogenases and related proteins Locus tag: Jann_1468 Name: null Funciton: oxidoreductase-like
	Jann_1460		short-chain dehydrogenase/reductase SDR
	Jann_1461	Jann_1461	oxidoreductase-like
	Jann_1462	COG1082	Sugar phosphate isomerases/epimerases
	Jann_1463	SMb20720	Sugar ABC transport system, substrate-binding protein
	Jann_1464	SMb20718	Sugar ABC transport system, ATP-binding protein
	Jann_1465	SMb20719	SugarABC transport system, inner membrane protein
	Jann_1466	SMb20719	SugarABC transport system, inner membrane protein
	Jann_1467	COG0673	Predicted dehydrogenases and related proteins
	Jann_1468		oxidoreductase-like

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD