Regulon of CadR-PbrR in Sphingobium japonicum UT26S

Properties
Regulator type:	Transcription factor
TF locus tag:	SJA_C1-05440
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Lead resistance; Cadmium resistance
Effector:	Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog:	CadR-PbrR - Sphingomonadales
Statistics of regulated genes:
- Genes	12
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Sphingomonadales
By trascription factor - CadR-PbrR
By TF family - MerR
By effector - Lead ion, (Pb2+)
By effector - Cadmium, ion (Cd2+)
By pathway - Lead resistance
By pathway - Cadmium resistance

Regulated operons
	Locus Tag	Name	Function
Position: -35 Score: 5.3 Sequence: CTTCTACAGCGACTGGAGGTG Locus tag: SJA_C1-05430 Name: czcD Funciton: Co/Zn/Cd efflux protein Locus tag: SJA_C1-05420 Name: pbrT Funciton: Pb(II) uptake protein, ILT family Locus tag: SJA_C1-05410 Name: null Funciton: hypothetical protein Locus tag: SJA_C1-05400 Name: czcC Funciton: Heavy metal efflux RND outer membrane protein Locus tag: SJA_C1-05390 Name: czcB Funciton: Heavy metal efflux RND transporter, membrane fusion protein Locus tag: SJA_C1-05380 Name: czcA Funciton: Heavy metal efflux RND transmembrane protein Locus tag: SJA_C1-05370 Name: null Funciton: hypothetical protein Locus tag: SJA_C1-05360 Name: null Funciton: hypothetical protein Locus tag: SJA_C1-05350 Name: null Funciton: hypothetical protein Locus tag: SJA_C1-05340 Name: PF02535 Funciton: Putative metal transporter Locus tag: SJA_C1-05330 Name: czcD2 Funciton: Co/Zn/Cd efflux protein Locus tag: SJA_C1-05320 Name: cadA Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
	SJA_C1-05430	czcD	Co/Zn/Cd efflux protein
	SJA_C1-05420	pbrT	Pb(II) uptake protein, ILT family
	SJA_C1-05410		hypothetical protein
	SJA_C1-05400	czcC	Heavy metal efflux RND outer membrane protein
	SJA_C1-05390	czcB	Heavy metal efflux RND transporter, membrane fusion protein
	SJA_C1-05380	czcA	Heavy metal efflux RND transmembrane protein
	SJA_C1-05370		hypothetical protein
	SJA_C1-05360		hypothetical protein
	SJA_C1-05350		hypothetical protein
	SJA_C1-05340	PF02535	Putative metal transporter
	SJA_C1-05330	czcD2	Co/Zn/Cd efflux protein
	SJA_C1-05320	cadA	Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD