Regulon of CadR-PbrR in Novosphingobium aromaticivorans DSM 12444

Properties
Regulator type:	Transcription factor
TF locus tag:	Saro_2152
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Lead resistance; Cadmium resistance
Effector:	Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog:	CadR-PbrR - Sphingomonadales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Sphingomonadales
By trascription factor - CadR-PbrR
By TF family - MerR
By effector - Lead ion, (Pb2+)
By effector - Cadmium, ion (Cd2+)
By pathway - Lead resistance
By pathway - Cadmium resistance

Regulated operons
	Locus Tag	Name	Function
Position: -63 Score: 4.6 Sequence: ACCCTGTAGTTGCTACAGGGT Locus tag: Saro_2151 Name: czcD Funciton: Co/Zn/Cd efflux protein Locus tag: Saro_2150 Name: null Funciton: hypothetical protein
	Saro_2151	czcD	Co/Zn/Cd efflux protein
	Saro_2150		hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD