Regulon of CadR-PbrR in Novosphingobium aromaticivorans DSM 12444
| Regulator type: | Transcription factor |
| TF locus tag: | Saro_2152 |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Lead resistance; Cadmium resistance |
| Effector: | Lead ion, (Pb2+); Cadmium, ion (Cd2+) |
| Regulog: | CadR-PbrR - Sphingomonadales |
| Statistics of regulated genes: | |
| - Genes | 2 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Sphingomonadales
- By trascription factor - CadR-PbrR
- By TF family - MerR
- By effector - Lead ion, (Pb2+)
- By effector - Cadmium, ion (Cd2+)
- By pathway - Lead resistance
- By pathway - Cadmium resistance
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -63
Score: 4.6 Sequence: ACCCTGTAGTTGCTACAGGGT
Locus tag: Saro_2151
Name: czcD Funciton: Co/Zn/Cd efflux protein
Locus tag: Saro_2150
Name: null Funciton: hypothetical protein |
|||
|
czcD
|
Co/Zn/Cd efflux protein
|
||
|
hypothetical protein
|
|||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |