Regulon of CueR in Pseudomonas mendocina ymp

Properties
Regulator type:	Transcription factor
TF locus tag:	Pmen_0812
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -57 Score: 5.6 Sequence: ACCTTGCCATGGGGTCAAGGT Locus tag: Pmen_0821 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
	Pmen_0821	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
Position: -8 Score: 5.7 Sequence: ACCTTGCCATGGTGGCAAGCT Locus tag: Pmen_0823 Name: copZ Funciton: Copper chaperone
	Pmen_0823	copZ	Copper chaperone
Position: -72 Score: 5.7 Sequence: ACCTTGCCATCGTGTCAAGGT Locus tag: Pmen_2225 Name: copZ Funciton: Copper chaperone
	Pmen_2225	copZ	Copper chaperone

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD