Regulon of CueR in Pseudomonas syringae pv. tomato str. DC3000

Properties
Regulator type:	Transcription factor
TF locus tag:	PSPTO0749
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -59 Score: 6 Sequence: ACCTTGCCATGATGGCAAGGT Locus tag: PSPTO0752 Name: copZ Funciton: Copper chaperone
	PSPTO0752	copZ	Copper chaperone
Position: -59 Score: 5.4 Sequence: ACCTTGCCCATGTGGCAAGGT Locus tag: PSPTO0750 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: PSPTO0749 Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family
	PSPTO0750	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
	PSPTO0749	cueR	Copper-responsive transcriptional regulator, MerR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD