Regulon of CueR in Pseudomonas putida KT2440

Properties
Regulator type:	Transcription factor
TF locus tag:	PP0585
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -56 Score: 5.3 Sequence: ACCTTGTCCTGATGGCAAGCT Locus tag: PP0588 Name: copZ Funciton: Copper chaperone
	PP0588	copZ	Copper chaperone
Position: -53 Score: 5.3 Sequence: ACCTTGCCTGCGTGGCAAGGT Locus tag: PP0586 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: PP0585 Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family
	PP0586	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
	PP0585	cueR	Copper-responsive transcriptional regulator, MerR family
Position: -71 Score: 5.2 Sequence: ACCTTGTCATCGTGTCAAGGT Locus tag: PP5393 Name: copZ2 Funciton: Copper chaperone
	PP5393	copZ2	Copper chaperone

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD