Regulon of CueR in Pseudomonas aeruginosa PAO1

Properties
Regulator type:	Transcription factor
TF locus tag:	PA4778
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -97 Score: 4.9 Sequence: ACCTTGACACGATGTCAAGGC Locus tag: PA3920 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
	PA3920	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
Position: -89 Score: 5.1 Sequence: ACCTTGCCAAGGTGTCAAGGT Locus tag: PA3523 Name: null Funciton: RND efflux system, membrane fusion protein Locus tag: PA3522 Name: null Funciton: RND efflux system, inner membrane transporter Locus tag: PA3521 Name: PA3521 Funciton: RND efflux system, outer membrane protein
	PA3523		RND efflux system, membrane fusion protein
	PA3522		RND efflux system, inner membrane transporter
	PA3521	PA3521	RND efflux system, outer membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD