Regulon of Caur_3448 in Herpetosiphon aurantiacus ATCC 23779

Properties
Regulator type:	Transcription factor
TF locus tag:	Haur_0778
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	Caur_3448 - Chloroflexia
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -32 Score: 5.7 Sequence: CTATTTAAACGTTTAAATAG Locus tag: Haur_0778 Name: Caur_3448 Funciton: Hypothetical sugar utilization transcriptional regulator , LacI family Locus tag: Haur_0777 Name: ggtA Funciton: Multiple sugar ABC transporter, ATP-binding protein, orthologs of ggtA-Synechocystis
	Haur_0778	Caur_3448	Hypothetical sugar utilization transcriptional regulator , LacI family
	Haur_0777	ggtA	Multiple sugar ABC transporter, ATP-binding protein, orthologs of ggtA-Synechocystis

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD