Regulon of FruR in Streptococcus equi subsp. zooepidemicus MGCS10565

Properties
Regulator type:	Transcription factor
TF locus tag:	Sez_1106
Regulator family:	DeoR
Regulation mode:	repressor
Biological process:	Fructose utilization
Effector:	Fructose-6-phosphate
Regulog:	FruR - Streptococcaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 34 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - DeoR
By effector - Fructose-6-phosphate
By pathway - Fructose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -117 Score: 4.9 Sequence: TGAATGTTTTTGAAAGATAG Position: -107 Score: 5.8 Sequence: TGAAAGATAGTGCTTGACTT Locus tag: Sez_1106 Name: fruR Funciton: Fructose utilization transcriptional regulator FruR, DeoR family Locus tag: Sez_1105 Name: fruB Funciton: 1-phosphofructokinase (EC 2.7.1.56) Locus tag: Sez_1104 Name: fruA Funciton: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)
	Sez_1106	fruR	Fructose utilization transcriptional regulator FruR, DeoR family
	Sez_1105	fruB	1-phosphofructokinase (EC 2.7.1.56)
	Sez_1104	fruA	Fructose-specific PTS, EIIABC component (EC 2.7.1.69)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD