Regulon of FruR in Streptococcus agalactiae 2603V/R

Properties
Regulator type:	Transcription factor
TF locus tag:	SAG1348
Regulator family:	DeoR
Regulation mode:	repressor
Biological process:	Fructose utilization
Effector:	Fructose-6-phosphate
Regulog:	FruR - Streptococcaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 34 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - DeoR
By effector - Fructose-6-phosphate
By pathway - Fructose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -85 Score: 5 Sequence: TGATAGTTTTTGGAAGAAAA Position: -75 Score: 5.8 Sequence: TGGAAGAAAATGCTTGACAT Locus tag: SAG1348 Name: fruR Funciton: Fructose utilization transcriptional regulator FruR, DeoR family Locus tag: SAG1347 Name: fruB Funciton: 1-phosphofructokinase (EC 2.7.1.56) Locus tag: SAG1346 Name: fruA Funciton: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)
	SAG1348	fruR	Fructose utilization transcriptional regulator FruR, DeoR family
	SAG1347	fruB	1-phosphofructokinase (EC 2.7.1.56)
	SAG1346	fruA	Fructose-specific PTS, EIIABC component (EC 2.7.1.69)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD