Regulon of NrtR in Mycobacterium avium 104

Properties
Regulator type:	Transcription factor
TF locus tag:	MAV_3192
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Mycobacteriaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Mycobacteriaceae
By trascription factor - NrtR
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -62 Score: 7.6 Sequence: GTTTTCGACTTATAATCGAAAAC Locus tag: MAV_3192 Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR
	MAV_3192	nrtR	Nudix-related transcriptional regulator NrtR
Position: -46 Score: 7.6 Sequence: GTTTTCGATTATAAGTCGAAAAC Locus tag: MAV_3191 Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-) Locus tag: MAV_3190 Name: nadB Funciton: L-aspartate oxidase (EC 1.4.3.16) Locus tag: MAV_3189 Name: nadC Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
	MAV_3191	nadA	Quinolinate synthetase (EC 4.1.99.-)
	MAV_3190	nadB	L-aspartate oxidase (EC 1.4.3.16)
	MAV_3189	nadC	Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD