Regulon of NrtR in Mycobacterium sp. JLS

Properties
Regulator type:	Transcription factor
TF locus tag:	Mjls_3086
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Mycobacteriaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Mycobacteriaceae
By trascription factor - NrtR
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -46 Score: 7.5 Sequence: GTTTTCGATTGTAAGTCGAAAAC Locus tag: Mjls_3085 Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-) Locus tag: Mjls_3084 Name: nadB Funciton: L-aspartate oxidase (EC 1.4.3.16) Locus tag: Mjls_3083 Name: nadC Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
	Mjls_3085	nadA	Quinolinate synthetase (EC 4.1.99.-)
	Mjls_3084	nadB	L-aspartate oxidase (EC 1.4.3.16)
	Mjls_3083	nadC	Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
Position: -23 Score: 7.5 Sequence: GTTTTCGACTTACAATCGAAAAC Locus tag: Mjls_3086 Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR
	Mjls_3086	nrtR	Nudix-related transcriptional regulator NrtR

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD