Regulon of GamR in Oceanobacillus iheyensis HTE831

Properties
Regulator type:	Transcription factor
TF locus tag:	OB2272
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Glucosamine utilization
Effector:	Glucosamine-6-phosphate
Regulog:	GamR - Bacillales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 25 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - GntR/Others
By effector - Glucosamine-6-phosphate
By pathway - Glucosamine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -81 Score: 5.8 Sequence: AAATTTGTTATAACACAATT Locus tag: OB2272 Name: gamR Funciton: Predicted transcriptional regulator of glucosamine utilization, GntR family Locus tag: OB2271 Name: null Funciton: Predicted chitooligosaccharide deacetylase
	OB2272	gamR	Predicted transcriptional regulator of glucosamine utilization, GntR family
	OB2271		Predicted chitooligosaccharide deacetylase
Position: -126 Score: 5.8 Sequence: AATTGTGTTATAACAAATTT Locus tag: OB2273 Name: licH Funciton: Cytoplasmic 6-phospho-beta-glucosidase (EC 3.2.1.86) Locus tag: OB2274 Name: ywbA Funciton: PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIC component (EC 2.7.1.69) Locus tag: OB2275 Name: ywbB Funciton: PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIA component (EC 2.7.1.69) Locus tag: OB2276 Name: ywbC Funciton: PTS system, predicted predicted N-acetylglucosamine oligosaccharide-specific IIB component (EC 2.7.1.69)
	OB2273	licH	Cytoplasmic 6-phospho-beta-glucosidase (EC 3.2.1.86)
	OB2274	ywbA	PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIC component (EC 2.7.1.69)
	OB2275	ywbB	PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIA component (EC 2.7.1.69)
	OB2276	ywbC	PTS system, predicted predicted N-acetylglucosamine oligosaccharide-specific IIB component (EC 2.7.1.69)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD