Regulon of PhnR in Moritella sp. PE36

Properties
Regulator type:	Transcription factor
TF locus tag:	PE36_23527
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector:
Regulog:	PhnR - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	7
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - PhnR
By TF family - GntR/Others
By pathway - Phosphonate utilization
By pathway - 2-aminoethylphosphonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -228 Score: 5.6 Sequence: ATTCTGGTCTGTACCAGATT Position: -17 Score: 5.7 Sequence: AAACTGGTATAGTCCAAATG Locus tag: PE36_23507 Name: phnW Funciton: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37) Locus tag: PE36_23502 Name: COG0160 Funciton: 4-aminobutyrate aminotransferase and related aminotransferases Locus tag: PE36_23497 Name: phnX Funciton: Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
	PE36_23507	phnW	2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
	PE36_23502	COG0160	4-aminobutyrate aminotransferase and related aminotransferases
	PE36_23497	phnX	Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
Position: -24 Score: 5.5 Sequence: ATACTGGTATAGTCCAAATA Locus tag: PE36_23517 Name: phnT Funciton: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) Locus tag: PE36_23522 Name: phnU Funciton: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9. Locus tag: PE36_23527 Name: phnR Funciton: 2-aminoethylphosphonate uptake and metabolism regulator, GntR family
	PE36_23517	phnT	2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
	PE36_23522	phnU	2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.
	PE36_23527	phnR	2-aminoethylphosphonate uptake and metabolism regulator, GntR family
Position: -261 Score: 5 Sequence: CATTTGGACTATACCAGTTT Position: -50 Score: 6.2 Sequence: AATCTGGTACAGACCAGAAT Locus tag: PE36_23512 Name: phnS Funciton: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
	PE36_23512	phnS	2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD