Regulon of PhnR in Psychromonas sp. CNPT3

Properties
Regulator type:	Transcription factor
TF locus tag:	PCNPT3_11544
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector:
Regulog:	PhnR - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - PhnR
By TF family - GntR/Others
By pathway - Phosphonate utilization
By pathway - 2-aminoethylphosphonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -253 Score: 5.4 Sequence: TATTTGGTGTAGACCAGAAT Locus tag: PCNPT3_11559 Name: phnS Funciton: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) Locus tag: PCNPT3_11554 Name: phnT Funciton: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) Locus tag: PCNPT3_11549 Name: phnU Funciton: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9. Locus tag: PCNPT3_11544 Name: phnR Funciton: 2-aminoethylphosphonate uptake and metabolism regulator, GntR family
	PCNPT3_11559	phnS	2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
	PCNPT3_11554	phnT	2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
	PCNPT3_11549	phnU	2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.
	PCNPT3_11544	phnR	2-aminoethylphosphonate uptake and metabolism regulator, GntR family
Position: -32 Score: 5.9 Sequence: ATTCTGGTCTACACCAAATA Locus tag: PCNPT3_11564 Name: phnW Funciton: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37) Locus tag: PCNPT3_11569 Name: phnX Funciton: Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
	PCNPT3_11564	phnW	2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
	PCNPT3_11569	phnX	Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD