Regulon of ModE in Laribacter hongkongensis HLHK9

Properties
Regulator type:	Transcription factor
TF locus tag:	LHK_02456
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Regulog:	ModE - Various betaproteobacteria
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Various betaproteobacteria
By trascription factor - ModE
By TF family - ModE
By effector - Molybdate
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -28 Score: 6 Sequence: CGTTATATAGTCGTGTATATTACG Locus tag: LHK_02456 Name: modE Funciton: Molybdate-responsive transcriptional regulator ModE Locus tag: LHK_02457 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: LHK_02458 Name: modX Funciton: Predicted molibdenum binding protein Locus tag: LHK_02459 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: LHK_02460 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
	LHK_02456	modE	Molybdate-responsive transcriptional regulator ModE
	LHK_02457	modA	Molybdate ABC transporter, substrate-binding protein
	LHK_02458	modX	Predicted molibdenum binding protein
	LHK_02459	modB	Molybdate ABC transporter, permease protein
	LHK_02460	modC	Molybdate ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD