Regulon of LldR in Rhodobacterales bacterium HTCC2654

Properties
Regulator type:	Transcription factor
TF locus tag:	RB2654_23238
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Lactate utilization
Effector:	L-lactate
Regulog:	LldR - Rhodobacterales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By trascription factor - LldR
By TF family - GntR/Others
By effector - L-lactate
By pathway - Lactate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -112 Score: 5.1 Sequence: GTGGTCAATAATATTTACCAC Locus tag: RB2654_23243 Name: dld Funciton: D-Lactate dehydrogenase
	RB2654_23243	dld	D-Lactate dehydrogenase
Position: -170 Score: 5.3 Sequence: GTGGTAAATATTATTGACCAC Locus tag: RB2654_23238 Name: lldR Funciton: Lactate-responsive regulator LldR, GntR family
	RB2654_23238	lldR	Lactate-responsive regulator LldR, GntR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD