Regulon of EbgR in Escherichia coli str. K-12 substr. MG1655

Properties
Regulator type:	Transcription factor
TF locus tag:	b3075
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactosides utilization
Effector:	Beta-galactosides
Regulog:	EbgR - Enterobacteriales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - Beta-galactosides
By pathway - Galactosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -94 Score: 6.2 Sequence: CTACTTTTTAGTAAAAATTTT Locus tag: b3076 Name: ebgA Funciton: Evolved beta-D-galactosidase, alpha subunit Locus tag: b3077 Name: ebgC Funciton: Evolved beta-D-galactosidase, beta subunit Locus tag: b3078 Name: ygjI Funciton: predicted beta-galactoside transporter, AAP family Locus tag: b3079 Name: ygjJ Funciton: hypothetical protein Locus tag: b3080 Name: ygjK Funciton: predicted glycosyl hydrolase
	b3076	ebgA	Evolved beta-D-galactosidase, alpha subunit
	b3077	ebgC	Evolved beta-D-galactosidase, beta subunit
	b3078	ygjI	predicted beta-galactoside transporter, AAP family
	b3079	ygjJ	hypothetical protein
	b3080	ygjK	predicted glycosyl hydrolase
Position: -201 Score: 5.7 Sequence: TAAAATTTTACTAAACTATAG Locus tag: b3075 Name: ebgR Funciton: Evolved beta-D-galactosidase transcriptional repressor, LacI family
	b3075	ebgR	Evolved beta-D-galactosidase transcriptional repressor, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD