Regulon of AcoR in Bacillus licheniformis DSM 13

Properties
Regulator type:	Transcription factor
TF locus tag:	BLi00853
Regulator family:	Fis
Regulation mode:	activator
Biological process:	Acetoin utilization
Effector:	Acetoin
Regulog:	AcoR - Bacillales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - Fis
By effector - Acetoin
By pathway - Acetoin utilization

Regulated operons
	Locus Tag	Name	Function
Position: -140 Score: 8 Sequence: GACAAATTGAGACATCTGTCTCGTTTTGTCTC Locus tag: BLi00849 Name: acoA Funciton: Acetoin dehydrogenase E1 component alpha-subunit (EC 1.2.4.-)
	BLi00849	acoA	Acetoin dehydrogenase E1 component alpha-subunit (EC 1.2.4.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD