Regulon of NrtR in Thermosynechococcus elongatus BP-1

Properties
Regulator type:	Transcription factor
TF locus tag:	tlr1179
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Cyanobacteria
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 17 sites [see more]

Member of regulog collections

By taxonomy - Cyanobacteria
By trascription factor - NrtR
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -67 Score: 5.8 Sequence: TTTTGGTAAAAGTCACTATAA Locus tag: null Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-)
	null	nadA	Quinolinate synthetase (EC 4.1.99.-)
Position: -48 Score: 6.3 Sequence: TTATGGTGAAACTCACTATAA Locus tag: tlr1177 Name: pncB Funciton: Nicotinate phosphoribosyltransferase (EC 2.4.2.11) Locus tag: tlr1178 Name: nadD Funciton: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) Locus tag: tlr1179 Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR Locus tag: tlr1180 Name: nadE Funciton: NAD synthetase (EC 6.3.1.5)
	tlr1177	pncB	Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
	tlr1178	nadD	Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18)
	tlr1179	nrtR	Nudix-related transcriptional regulator NrtR
	tlr1180	nadE	NAD synthetase (EC 6.3.1.5)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD