Regulon of NrtR in Trichodesmium erythraeum IMS101

Properties
Regulator type:	Transcription factor
TF locus tag:	Tery_0320
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Cyanobacteria
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 17 sites [see more]

Member of regulog collections

By taxonomy - Cyanobacteria
By trascription factor - NrtR
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -85 Score: 4.6 Sequence: TTATAGTATAATTCATCAAAC Locus tag: Tery_2446 Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-)
	Tery_2446	nadA	Quinolinate synthetase (EC 4.1.99.-)
Position: -173 Score: 5.9 Sequence: ATATAGTAAGAATAACTATAA Locus tag: Tery_0318 Name: pncB Funciton: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
	Tery_0318	pncB	Nicotinate phosphoribosyltransferase (EC 2.4.2.11)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD