Regulon of AscG in Escherichia coli str. K-12 substr. MG1655

Properties
Regulator type:	Transcription factor
TF locus tag:	b2714
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization; Cellobiose utilization
Effector:	Cellobiose-6-phosphate; Beta-glucoside-6-phosphate
Regulog:	AscG - Enterobacteriales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 28 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - Cellobiose-6-phosphate
By effector - Beta-glucoside-6-phosphate
By pathway - Beta-glucosides utilization
By pathway - Cellobiose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -177 Score: 5.1 Sequence: TCAGGTGACCGGTTTCACAA Position: -101 Score: 5.8 Sequence: TTGTGAAACCGGTTTCTTAA Locus tag: b2715 Name: ascF Funciton: PTS system, arbutin-, cellobiose-, and salicin-specific IIBC component (EC 2.7.1.69) Locus tag: b2716 Name: ascB Funciton: 6-phospho-beta-glucosidase ascB (EC 3.2.1.86)
	b2715	ascF	PTS system, arbutin-, cellobiose-, and salicin-specific IIBC component (EC 2.7.1.69)
	b2716	ascB	6-phospho-beta-glucosidase ascB (EC 3.2.1.86)
Position: -175 Score: 6.3 Sequence: TTAAGAAACCGGTTTCACAA Locus tag: b2714 Name: ascG Funciton: Transcriptional repressor of arbutine, salicine, cellibiose utilization, LacI family
	b2714	ascG	Transcriptional repressor of arbutine, salicine, cellibiose utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD