Regulon of AscG in Citrobacter koseri ATCC BAA-895

Properties
Regulator type:	Transcription factor
TF locus tag:	CKO_04069
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization; Cellobiose utilization
Effector:	Cellobiose-6-phosphate; Beta-glucoside-6-phosphate
Regulog:	AscG - Enterobacteriales
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 28 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - Cellobiose-6-phosphate
By effector - Beta-glucoside-6-phosphate
By pathway - Beta-glucosides utilization
By pathway - Cellobiose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -117 Score: 5.6 Sequence: TACTGCAACCGGTTTCAGTT Locus tag: CKO_02999 Name: celA2 Funciton: PTS system, cellobiose-specific IIB component (EC 2.7.1.69) Locus tag: CKO_03000 Name: celC2 Funciton: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
	CKO_02999	celA2	PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
	CKO_03000	celC2	PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
Position: -172 Score: 6.7 Sequence: ATAGGAAACCGGTTCCACAA Locus tag: CKO_04069 Name: ascG Funciton: Transcriptional repressor of arbutine, salicine, cellibiose utilization, LacI family
	CKO_04069	ascG	Transcriptional repressor of arbutine, salicine, cellibiose utilization, LacI family
Position: -103 Score: 5.1 Sequence: TTGTGGAACCGGTTTCCTAT Locus tag: CKO_04070 Name: ascF Funciton: PTS system, arbutin-, cellobiose-, and salicin-specific IIBC component (EC 2.7.1.69) Locus tag: CKO_04071 Name: ascB Funciton: 6-phospho-beta-glucosidase ascB (EC 3.2.1.86)
	CKO_04070	ascF	PTS system, arbutin-, cellobiose-, and salicin-specific IIBC component (EC 2.7.1.69)
	CKO_04071	ascB	6-phospho-beta-glucosidase ascB (EC 3.2.1.86)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD