Regulon of Crp in Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Properties
Regulator type:	Transcription factor
TF locus tag:	KPN_03743
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Carbon catabolism
Effector:	Cyclic 3',5'-AMP
Regulog:	Crp - Enterobacteriales
Statistics of regulated genes:
- Genes	378
- Operons	196
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2301 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - CRP
By effector - Cyclic 3',5'-AMP
By pathway - Carbon catabolism

Regulated operons
	Locus Tag	Name	Function
Position: -158 Score: 3.3 Sequence: TACATTGATGTACTGCATGTAT Locus tag: KPN_03743 Name: crp Funciton: cyclic AMP receptor protein
	KPN_03743	crp	cyclic AMP receptor protein
Position: -264 Score: 4.7 Sequence: TTAAGTGACAGAAATCACACTT Position: -242 Score: 3.9 Sequence: AAAAATGATCTAAAACAAAAAT Locus tag: KPN_02726 Name: fadL Funciton: Long-chain fatty acid transport protein
	KPN_02726	fadL	Long-chain fatty acid transport protein
Position: -162 Score: 4.3 Sequence: ACATGTGAGCAAGATCAAACTT Locus tag: KPN_02834 Name: guaB Funciton: inosine-5'-monophosphate dehydrogenase Locus tag: KPN_02833 Name: guaA Funciton: bifunctional GMP synthase/glutamine amidotransferase protein
	KPN_02834	guaB	inosine-5'-monophosphate dehydrogenase
	KPN_02833	guaA	bifunctional GMP synthase/glutamine amidotransferase protein
Position: -155 Score: 3.2 Sequence: AAATGTTATTTCTGTAAGGTTG Position: -118 Score: 3.2 Sequence: TTTACTGATTTCAATCAAAACC Locus tag: KPN_00117 Name: pdhR Funciton: Transcriptional repressor for pyruvate dehydrogenase complex Locus tag: KPN_00118 Name: aceE Funciton: Pyruvate dehydrogenase E1 component (EC 1.2.4.1) Locus tag: KPN_00119 Name: aceF Funciton: Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex (EC 2.3.1.12)
	KPN_00117	pdhR	Transcriptional repressor for pyruvate dehydrogenase complex
	KPN_00118	aceE	Pyruvate dehydrogenase E1 component (EC 1.2.4.1)
	KPN_00119	aceF	Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex (EC 2.3.1.12)
Position: -236 Score: 3.8 Sequence: AACAATGACCGACATCGCATAA Locus tag: KPN_02641 Name: ubiG Funciton: 3-demethylubiquinone-9 3-methyltransferase (EC 2.1.1.64)
	KPN_02641	ubiG	3-demethylubiquinone-9 3-methyltransferase (EC 2.1.1.64)
Position: -55 Score: 5.1 Sequence: ATGTGTGATCTAAATCACTTTT Locus tag: KPN_03652 Name: aaeR Funciton: LysR-family transcriptional regulator
	KPN_03652	aaeR	LysR-family transcriptional regulator
Position: -95 Score: 3.8 Sequence: AGGCATGATGTTAATCATAAAT Locus tag: KPN_02687 Name: ackA Funciton: acetate kinase Locus tag: KPN_02688 Name: pta Funciton: phosphate acetyltransferase
	KPN_02687	ackA	acetate kinase
	KPN_02688	pta	phosphate acetyltransferase
Position: -101 Score: 3.9 Sequence: TTGCGTGATCTGCCCCCCAATT Locus tag: KPN_04478 Name: acs Funciton: acetyl-coenzyme A synthetase Locus tag: KPN_04477 Name: yjcH Funciton: membrane protein Locus tag: KPN_04476 Name: actP Funciton: acetate permease
	KPN_04478	acs	acetyl-coenzyme A synthetase
	KPN_04477	yjcH	membrane protein
	KPN_04476	actP	acetate permease
Position: -137 Score: 4.4 Sequence: TTTTATGAATCAGCTCACAGAA Locus tag: KPN_01501 Name: aldA Funciton: aldehyde dehydrogenase A
	KPN_01501	aldA	aldehyde dehydrogenase A
Position: -130 Score: 3.9 Sequence: ATATTTGCACGGCGTCACACTT Locus tag: KPN_00062 Name: araB Funciton: L-ribulokinase Locus tag: KPN_00061 Name: araA Funciton: L-arabinose isomerase Locus tag: KPN_00060 Name: araD Funciton: L-ribulose-5-phosphate 4-epimerase
	KPN_00062	araB	L-ribulokinase
	KPN_00061	araA	L-arabinose isomerase
	KPN_00060	araD	L-ribulose-5-phosphate 4-epimerase
Position: -229 Score: 4.4 Sequence: AAGTGTGACGCCGTGCAAATAT Locus tag: KPN_00063 Name: araC Funciton: DNA-binding transcriptional dual regulator
	KPN_00063	araC	DNA-binding transcriptional dual regulator
Position: -191 Score: 4.4 Sequence: AAGTTTAATGTCCATCACAAAA Locus tag: KPN_03264 Name: araE Funciton: sugar transporter
	KPN_03264	araE	sugar transporter
Position: -161 Score: 4 Sequence: CGATGTGATAATGCTCTCGTAT Position: -72 Score: 3.6 Sequence: TGTTTTGATGACGATTAAATTG Locus tag: KPN_02396 Name: araF Funciton: L-arabinose-binding periplasmic protein Locus tag: KPN_02395 Name: araG Funciton: L-arabinose transporter ATP-binding protein Locus tag: KPN_02394 Name: araH Funciton: L-arabinose transporter permease protein
	KPN_02396	araF	L-arabinose-binding periplasmic protein
	KPN_02395	araG	L-arabinose transporter ATP-binding protein
	KPN_02394	araH	L-arabinose transporter permease protein
Position: -27 Score: 4 Sequence: TATTGTATTTTTATTCAAAATA Locus tag: KPN_04246 Name: argE Funciton: acetylornithine deacetylase
	KPN_04246	argE	acetylornithine deacetylase
Position: -107 Score: 3.8 Sequence: CCCTGCGATGCAGATCACACAA Locus tag: KPN_03350 Name: iciA Funciton: chromosome replication initiation inhibitor protein
	KPN_03350	iciA	chromosome replication initiation inhibitor protein
Position: -159 Score: 3.8 Sequence: TATTGTTATACGCATCGCGCCA Locus tag: KPN_02923 Name: aroF Funciton: phospho-2-dehydro-3-deoxyheptonate aldolase Locus tag: KPN_02922 Name: tyrA Funciton: T-protein [includes: chorismate mutase and prephenate dehydrogenase]
	KPN_02923	aroF	phospho-2-dehydro-3-deoxyheptonate aldolase
	KPN_02922	tyrA	T-protein [includes: chorismate mutase and prephenate dehydrogenase]
Position: -63 Score: 4 Sequence: TATCGTGATGCGCATCACTTCC Locus tag: KPN_02162 Name: aroH Funciton: phospho-2-dehydro-3-deoxyheptonate aldolase
	KPN_02162	aroH	phospho-2-dehydro-3-deoxyheptonate aldolase
Position: -168 Score: 4.1 Sequence: CTTAGCGATCAAAATCACAAAA Locus tag: KPN_03051 Name: ascF Funciton: hypothetical protein Locus tag: KPN_03052 Name: ascB Funciton: 6-phospho-beta-glucosidase
	KPN_03051	ascF	hypothetical protein
	KPN_03052	ascB	6-phospho-beta-glucosidase
Position: -204 Score: 3.9 Sequence: AGCGGTGACCCATTTCACAGAT Position: -154 Score: 3.8 Sequence: ATAAGTGATCAAGCTTACTGAT Locus tag: KPN_04529 Name: aspA Funciton: aspartate ammonia-lyase Locus tag: KPN_04528 Name: dcuA Funciton: anaerobic C-4-dicarboxylate symporter
	KPN_04529	aspA	aspartate ammonia-lyase
	KPN_04528	dcuA	anaerobic C-4-dicarboxylate symporter
Position: -274 Score: 4 Sequence: TATCTTGATGATCTTCAAAAAG Locus tag: KPN_01493 Name: astC Funciton: bifunctional succinylornithine transaminase/acetylornithine transaminase Locus tag: KPN_01494 Name: astA Funciton: arginine succinyltransferase Locus tag: KPN_01495 Name: astD Funciton: succinylglutamic semialdehyde dehydrogenase Locus tag: KPN_01496 Name: astB Funciton: succinylarginine dihydrolase Locus tag: KPN_01497 Name: astE Funciton: succinylglutamate desuccinylase
	KPN_01493	astC	bifunctional succinylornithine transaminase/acetylornithine transaminase
	KPN_01494	astA	arginine succinyltransferase
	KPN_01495	astD	succinylglutamic semialdehyde dehydrogenase
	KPN_01496	astB	succinylarginine dihydrolase
	KPN_01497	astE	succinylglutamate desuccinylase
Position: -262 Score: 4.7 Sequence: TTATGTGATCTGATGCACGCTT Locus tag: KPN_04144 Name: atpI Funciton: ATP synthase subunit I Locus tag: KPN_04143 Name: atpB Funciton: ATP synthase subunit A Locus tag: KPN_04142 Name: atpE Funciton: ATP synthase subunit C Locus tag: KPN_04141 Name: atpF Funciton: ATP synthase subunit B Locus tag: KPN_04140 Name: atpH Funciton: ATP synthase subunit D Locus tag: KPN_04139 Name: atpA Funciton: ATP synthase subunit A Locus tag: KPN_04138 Name: atpG Funciton: ATP synthase subunit C Locus tag: KPN_04137 Name: atpD Funciton: ATP synthase subunit B Locus tag: KPN_04136 Name: atpC Funciton: ATP synthase epsilon subunit
	KPN_04144	atpI	ATP synthase subunit I
	KPN_04143	atpB	ATP synthase subunit A
	KPN_04142	atpE	ATP synthase subunit C
	KPN_04141	atpF	ATP synthase subunit B
	KPN_04140	atpH	ATP synthase subunit D
	KPN_04139	atpA	ATP synthase subunit A
	KPN_04138	atpG	ATP synthase subunit C
	KPN_04137	atpD	ATP synthase subunit B
	KPN_04136	atpC	ATP synthase epsilon subunit
Position: -102 Score: 4.3 Sequence: CTGAGTGATCCACTTCACCTTT Locus tag: KPN_02796 Name: b2462 Funciton: putative carboxysome structural protein, ethanol utilization Locus tag: KPN_02795 Name: eutP Funciton: putative ethanolamine utilization protein Locus tag: KPN_02794 Name: eutQ Funciton: hypothetical protein Locus tag: KPN_02793 Name: eutT Funciton: predicted cobalamin adenosyltransferase in ethanolamine utilization Locus tag: KPN_02792 Name: eutI Funciton: predicted phosphotransacetylase subunit Locus tag: KPN_02791 Name: cchA Funciton: detox protein Locus tag: KPN_02790 Name: cchB Funciton: hypothetical protein Locus tag: KPN_02789 Name: eutE Funciton: ethanolamine utilization protein Locus tag: KPN_02788 Name: eutJ Funciton: ethanolamine utilization protein Locus tag: KPN_02787 Name: eutG Funciton: ethanolamine utilization enzyme
	KPN_02796	b2462	putative carboxysome structural protein, ethanol utilization
	KPN_02795	eutP	putative ethanolamine utilization protein
	KPN_02794	eutQ	hypothetical protein
	KPN_02793	eutT	predicted cobalamin adenosyltransferase in ethanolamine utilization
	KPN_02792	eutI	predicted phosphotransacetylase subunit
	KPN_02791	cchA	detox protein
	KPN_02790	cchB	hypothetical protein
	KPN_02789	eutE	ethanolamine utilization protein
	KPN_02788	eutJ	ethanolamine utilization protein
	KPN_02787	eutG	ethanolamine utilization enzyme
Position: -154 Score: 4.2 Sequence: AGTCGCGATCTTAATCACGTTT Locus tag: KPN_02579 Name: arbG Funciton: transcriptional antiterminator, BglG
	KPN_02579	arbG	transcriptional antiterminator, BglG
Position: -78 Score: 4.4 Sequence: GAATGAGATATTCATCACATAT Locus tag: KPN_02584 Name: cdd Funciton: cytidine deaminase
	KPN_02584	cdd	cytidine deaminase
Position: -230 Score: 4.1 Sequence: ATCCGTGAGATTTCTCACAAAG Locus tag: KPN_01999 Name: cfa Funciton: cyclopropane fatty acyl phospholipid synthase
	KPN_01999	cfa	cyclopropane fatty acyl phospholipid synthase
Position: -269 Score: 4.3 Sequence: TAATGTGAAGCTTCCCAAATTA Locus tag: KPN_00054 Name: citA Funciton: signal transduction histidine kinase regulating citrate/malate metabolism Locus tag: KPN_00053 Name: citB Funciton: response regulator receiver and unknown domain protein
	KPN_00054	citA	signal transduction histidine kinase regulating citrate/malate metabolism
	KPN_00053	citB	response regulator receiver and unknown domain protein
Position: -106 Score: 4.5 Sequence: CTTCGTGATGCCGATCATAAAT Locus tag: KPN_03912 Name: CKO_05006 Funciton: Xylose isomerase domain protein TIM barrel Locus tag: KPN_03913 Name: CKO_05007 Funciton: PfkB domain protein Locus tag: KPN_03914 Name: CKO_05008 Funciton: major facilitator superfamily MFS_1 Locus tag: KPN_03915 Name: tkrA Funciton: 2-hydroxyacid dehydrogenase
	KPN_03912	CKO_05006	Xylose isomerase domain protein TIM barrel
	KPN_03913	CKO_05007	PfkB domain protein
	KPN_03914	CKO_05008	major facilitator superfamily MFS_1
	KPN_03915	tkrA	2-hydroxyacid dehydrogenase
Position: -167 Score: 4 Sequence: AAATTTGAAGCAGTTAACGCTA Position: -77 Score: 4.3 Sequence: ATTTGTGATGAGCATAACCTCT Locus tag: KPN_00914 Name: clpS Funciton: ATP-dependent Clp protease adaptor protein Locus tag: KPN_00915 Name: clpA Funciton: ATP-dependent CLP protease ATP-binding subunit
	KPN_00914	clpS	ATP-dependent Clp protease adaptor protein
	KPN_00915	clpA	ATP-dependent CLP protease ATP-binding subunit
Position: -156 Score: 3.8 Sequence: TTGTTTTATTTATATCGCATCA Position: -87 Score: 3.7 Sequence: TTTTCTGGCAAGATTCACATTT Position: -35 Score: 4.2 Sequence: TTCTGTGCTATCGCTCATAAAA Locus tag: KPN_04607 Name: cpdB Funciton: 2',3'-cyclic-nucleotide 2'-phosphodiesterase precursor
	KPN_04607	cpdB	2',3'-cyclic-nucleotide 2'-phosphodiesterase precursor
Position: -42 Score: 3.8 Sequence: TTTTTTAATAATGGTAACAATA Locus tag: KPN_04852 Name: creA Funciton: hypothetical protein Locus tag: KPN_04853 Name: creB Funciton: DNA-binding response regulator CreB Locus tag: KPN_04854 Name: creC Funciton: sensory histidine kinase CreC Locus tag: KPN_04855 Name: creD Funciton: tolerance to colicin E2
	KPN_04852	creA	hypothetical protein
	KPN_04853	creB	DNA-binding response regulator CreB
	KPN_04854	creC	sensory histidine kinase CreC
	KPN_04855	creD	tolerance to colicin E2
Position: -270 Score: 4.2 Sequence: AGAGGTTATGCTCATCACAAAT Position: -180 Score: 4 Sequence: TAGCGTTAACTGCTTCAAATTT Locus tag: KPN_00913 Name: cspD Funciton: cold shock-like protein
	KPN_00913	cspD	cold shock-like protein
Position: -138 Score: 4.1 Sequence: TTAAGTGATCTCGCTAGCAATG Locus tag: KPN_00616 Name: cstA2 Funciton: carbon starvation protein Locus tag: KPN_00617 Name: ybdD Funciton: hypothetical protein
	KPN_00616	cstA2	carbon starvation protein
	KPN_00617	ybdD	hypothetical protein
Position: -192 Score: 4.7 Sequence: TTTTGTGAGCTATTTCGCGTTA Position: -169 Score: 3.8 Sequence: ATGAGTGATATAACACTCACTT Locus tag: KPN_04601 Name: cycA2 Funciton: D-alanine/D-serine/glycine permease
	KPN_04601	cycA2	D-alanine/D-serine/glycine permease
Position: -252 Score: 3.6 Sequence: TATATTGATCACCGTCGAAAAA Locus tag: KPN_00736 Name: cydA Funciton: cytochrome d terminal oxidase, polypeptide subunit I Locus tag: KPN_00737 Name: cydB Funciton: cytochrome D ubiquinol oxidase subunit II Locus tag: KPN_00738 Name: ybgT Funciton: hypothetical protein Locus tag: KPN_00739 Name: ybgE Funciton: hypothetical protein
	KPN_00736	cydA	cytochrome d terminal oxidase, polypeptide subunit I
	KPN_00737	cydB	cytochrome D ubiquinol oxidase subunit II
	KPN_00738	ybgT	hypothetical protein
	KPN_00739	ybgE	hypothetical protein
Position: -178 Score: 4.1 Sequence: TTTTATGAGCGATAGCACAGAA Position: -126 Score: 3.7 Sequence: AAATGTGAATCTTGCCAGAAAA Position: -57 Score: 3.9 Sequence: TGATGCGATATAAATAAAACAA Locus tag: KPN_04608 Name: cysQ Funciton: PAPS (adenosine 3'-phosphate 5'-phosphosulfate) 3'(2'),5'-bisphosphate nucleotidase
	KPN_04608	cysQ	PAPS (adenosine 3'-phosphate 5'-phosphosulfate) 3'(2'),5'-bisphosphate nucleotidase
Position: -162 Score: 3.6 Sequence: TCTTGCGAGCCGGATCGAAAAA Position: -143 Score: 3.9 Sequence: AAATTTAACAAGCATCACGTTT Locus tag: KPN_04229 Name: cytR Funciton: transcriptional repressor
	KPN_04229	cytR	transcriptional repressor
Position: -106 Score: 4.1 Sequence: TGCTGTGAGTTAAGTCACCATA Locus tag: KPN_02309 Name: dadA Funciton: D-amino acid dehydrogenase small subunit Locus tag: KPN_02308 Name: dadX Funciton: alanine racemase
	KPN_02309	dadA	D-amino acid dehydrogenase small subunit
	KPN_02308	dadX	alanine racemase
Position: -143 Score: 3.9 Sequence: TTGTGCGAGTCAGCTCAAAGAT Locus tag: KPN_03878 Name: dctA Funciton: C4-dicarboxylate transport protein
	KPN_03878	dctA	C4-dicarboxylate transport protein
Position: -154 Score: 3.8 Sequence: TTTTTTGCTTGCCATCACCTTC Position: -99 Score: 4.4 Sequence: TACTTTGAGCCGGTTCACACAT Locus tag: KPN_03570 Name: deaD Funciton: ATP-independent RNA helicase
	KPN_03570	deaD	ATP-independent RNA helicase
Position: -158 Score: 5.2 Sequence: ATTTGTGATTTTAATCACGTTA Position: -105 Score: 3.7 Sequence: AACTGTGATGAATGTCGAAGTG Locus tag: KPN_04837 Name: deoC Funciton: 2-deoxyribose-5-phosphate aldolase Locus tag: KPN_04838 Name: deoA Funciton: thymidine phosphorylase Locus tag: KPN_04839 Name: deoB Funciton: phosphopentomutase Locus tag: KPN_04840 Name: deoD Funciton: purine nucleoside phosphorylase
	KPN_04837	deoC	2-deoxyribose-5-phosphate aldolase
	KPN_04838	deoA	thymidine phosphorylase
	KPN_04839	deoB	phosphopentomutase
	KPN_04840	deoD	purine nucleoside phosphorylase
Position: -154 Score: 4.1 Sequence: TTTTGTGATCCAAATTGTAGTA Locus tag: KPN_04098 Name: dgoR Funciton: GntR domain protein Locus tag: KPN_04097 Name: dgoK Funciton: 2-dehydro-3-deoxygalactonokinase Locus tag: KPN_04096 Name: dgoA2 Funciton: 2-dehydro-3-deoxy-6-phosphogalactonate aldolase Locus tag: KPN_04095 Name: dgoA1 Funciton: Mandelate racemase/muconate lactonizing enzyme, N-terminal domain protein Locus tag: KPN_04094 Name: dgoT Funciton: D-galactonate transport
	KPN_04098	dgoR	GntR domain protein
	KPN_04097	dgoK	2-dehydro-3-deoxygalactonokinase
	KPN_04096	dgoA2	2-dehydro-3-deoxy-6-phosphogalactonate aldolase
	KPN_04095	dgoA1	Mandelate racemase/muconate lactonizing enzyme, N-terminal domain protein
	KPN_04094	dgoT	D-galactonate transport
Position: -62 Score: 4 Sequence: ATATGCAAACAACATCACAATT Locus tag: KPN_03899 Name: dppA Funciton: dipeptide ABC transporter, substrate-binding protein Locus tag: KPN_03898 Name: dppB Funciton: dipeptide ABC transporter, permease protein Locus tag: KPN_03897 Name: dppC Funciton: dipeptide transporter Locus tag: KPN_03896 Name: dppD Funciton: dipeptide transporter ATP-binding subunit Locus tag: KPN_03895 Name: dppF Funciton: dipeptide transporter ATP-binding subunit
	KPN_03899	dppA	dipeptide ABC transporter, substrate-binding protein
	KPN_03898	dppB	dipeptide ABC transporter, permease protein
	KPN_03897	dppC	dipeptide transporter
	KPN_03896	dppD	dipeptide transporter ATP-binding subunit
	KPN_03895	dppF	dipeptide transporter ATP-binding subunit
Position: -125 Score: 3.9 Sequence: AAAGGTGATTTAGCTCTAAAAG Position: -95 Score: 4.2 Sequence: AAATATGCTATGGGTCAAATTA Locus tag: KPN_04079 Name: dsdC Funciton: DNA-binding transcriptional dual regulator
	KPN_04079	dsdC	DNA-binding transcriptional dual regulator
Position: -152 Score: 4.3 Sequence: TAATTTGACCCATAGCATATTT Position: -122 Score: 3.7 Sequence: CTTTTAGAGCTAAATCACCTTT Locus tag: KPN_04080 Name: dsdX Funciton: DsdX permease Locus tag: KPN_04081 Name: dsdA Funciton: D-serine dehydratase
	KPN_04080	dsdX	DsdX permease
	KPN_04081	dsdA	D-serine dehydratase
Position: -213 Score: 4.8 Sequence: AAATGTGATGTGAGTCATATAG Locus tag: KPN_03356 Name: epd Funciton: D-erythrose 4-phosphate dehydrogenase Locus tag: KPN_03355 Name: pgk Funciton: phosphoglycerate kinase
	KPN_03356	epd	D-erythrose 4-phosphate dehydrogenase
	KPN_03355	pgk	phosphoglycerate kinase
Position: -125 Score: 3.7 Sequence: TTTTTTGATCAAAATCAGCATC Position: -88 Score: 3.7 Sequence: TGGTGTGATGCACAGAGCAAAG Position: -69 Score: 3.7 Sequence: AAGTGTGAACAATATCACGCGA Locus tag: KPN_02226 Name: CKO_01286 Funciton: hypothetical protein
	KPN_02226	CKO_01286	hypothetical protein
Position: -263 Score: 4.4 Sequence: TTTTGTGACAGCTCTCAACTTT Locus tag: KPN_03521 Name: exuT Funciton: Hexuronate transporter
	KPN_03521	exuT	Hexuronate transporter
Position: -97 Score: 3.7 Sequence: AATAGTGACGCGCTTCGCAACC Locus tag: KPN_02322 Name: fadD Funciton: long-chain-fatty-acid--CoA ligase Locus tag: KPN_02321 Name: rnd Funciton: ribonuclease D
	KPN_02322	fadD	long-chain-fatty-acid--CoA ligase
	KPN_02321	rnd	ribonuclease D
Position: -111 Score: 3.9 Sequence: TTCTTTGAATCCCATCACAATC Locus tag: KPN_03510 Name: fadH Funciton: 2,4-dienoyl-CoA reductase [NADPH] (2,4-dienoyl coenzyme A reductase)
	KPN_03510	fadH	2,4-dienoyl-CoA reductase [NADPH] (2,4-dienoyl coenzyme A reductase)
Position: -164 Score: 3.9 Sequence: TTTTCTTATCCGGGGCACATTT Locus tag: KPN_04626 Name: fbp Funciton: fructose-1,6-bisphosphatase
	KPN_04626	fbp	fructose-1,6-bisphosphatase
Position: -121 Score: 3.8 Sequence: AGATATGATCTATATCAATTTC Locus tag: KPN_00932 Name: focA Funciton: formate transporter Locus tag: KPN_00931 Name: pflB Funciton: formate acetyltransferase
	KPN_00932	focA	formate transporter
	KPN_00931	pflB	formate acetyltransferase
Position: -177 Score: 3.5 Sequence: AAGTGTGCAGTACCTCTAAGTT Locus tag: KPN_02600 Name: fruB Funciton: PTS system, fructose-specific IIA/FPr component Locus tag: KPN_02599 Name: fruK Funciton: 1-phosphofructokinase Locus tag: KPN_02598 Name: fruA Funciton: PTS system, fructose-specific IIBC component
	KPN_02600	fruB	PTS system, fructose-specific IIA/FPr component
	KPN_02599	fruK	1-phosphofructokinase
	KPN_02598	fruA	PTS system, fructose-specific IIBC component
Position: -197 Score: 3.8 Sequence: AATTGCGACTTCCTTCAAACCT Locus tag: KPN_00460 Name: fsr Funciton: fosmidomycin resistance protein
	KPN_00460	fsr	fosmidomycin resistance protein
Position: -155 Score: 4.4 Sequence: ATAATTGACGCGGCTCACAAAA Locus tag: KPN_03151 Name: fucA Funciton: L-fuculose phosphate aldolase Locus tag: KPN_03150 Name: fucO Funciton: L-1,2-propanediol oxidoreductase
	KPN_03151	fucA	L-fuculose phosphate aldolase
	KPN_03150	fucO	L-1,2-propanediol oxidoreductase
Position: -260 Score: 4.7 Sequence: TAAAGTGACAATAATCACATAA Position: -220 Score: 4.6 Sequence: AAGTGTGACCATCATCATATTA Locus tag: KPN_03152 Name: fucP Funciton: L-fucose permease Locus tag: KPN_03153 Name: fucI Funciton: L-fucose isomerase Locus tag: KPN_03154 Name: fucK Funciton: L-fuculokinase Locus tag: KPN_03155 Name: fucU Funciton: conserved protein of fucose operon Locus tag: KPN_03156 Name: fucR Funciton: DNA-binding transcriptional activator
	KPN_03152	fucP	L-fucose permease
	KPN_03153	fucI	L-fucose isomerase
	KPN_03154	fucK	L-fuculokinase
	KPN_03155	fucU	conserved protein of fucose operon
	KPN_03156	fucR	DNA-binding transcriptional activator
Position: -140 Score: 3.7 Sequence: ATCTGTGAAATGGGTCACCGCT Locus tag: KPN_04530 Name: fxsA Funciton: suppressor of F plamsid exlusion of phage T7
	KPN_04530	fxsA	suppressor of F plamsid exlusion of phage T7
Position: -78 Score: 3.7 Sequence: TAACTTGTGCTATGTCACACTT Position: -44 Score: 4.1 Sequence: ATATGCTATCTTCCTCACAAAC Locus tag: KPN_00773 Name: galE2 Funciton: UDP-galactose-4-epimerase Locus tag: KPN_00772 Name: galT Funciton: galactose-1-phosphate uridylyltransferase Locus tag: KPN_00771 Name: galK Funciton: galactokinase Locus tag: KPN_00770 Name: galM Funciton: aldose 1-epimerase
	KPN_00773	galE2	UDP-galactose-4-epimerase
	KPN_00772	galT	galactose-1-phosphate uridylyltransferase
	KPN_00771	galK	galactokinase
	KPN_00770	galM	aldose 1-epimerase
Position: -84 Score: 3.8 Sequence: AGCCGTGATTATAGTCACGTTT Locus tag: KPN_03376 Name: galP Funciton: sugar transporter
	KPN_03376	galP	sugar transporter
Position: -225 Score: 5.2 Sequence: AATTGTGACTTAAATCACGTTT Locus tag: KPN_01197 Name: gapA Funciton: glyceraldehyde-3-phosphate dehydrogenase Locus tag: KPN_01196 Name: yeaD Funciton: Aldose 1-epimerase
	KPN_01197	gapA	glyceraldehyde-3-phosphate dehydrogenase
	KPN_01196	yeaD	Aldose 1-epimerase
Position: -125 Score: 4.8 Sequence: AGGAGTGATGCCGATCACATTT Locus tag: KPN_03540 Name: garD Funciton: D-galactarate dehydratase
	KPN_03540	garD	D-galactarate dehydratase
Position: -289 Score: 4.5 Sequence: AAATGTGATCGGCATCACTCCT Locus tag: KPN_03539 Name: garP Funciton: d-galactonate transporter Locus tag: KPN_03538 Name: garL Funciton: alpha-dehydro-beta-deoxy-D-glucarate aldolase Locus tag: KPN_03537 Name: garR Funciton: tartronate semialdehyde reductase Locus tag: KPN_03536 Name: garK Funciton: glycerate kinase I
	KPN_03539	garP	d-galactonate transporter
	KPN_03538	garL	alpha-dehydro-beta-deoxy-D-glucarate aldolase
	KPN_03537	garR	tartronate semialdehyde reductase
	KPN_03536	garK	glycerate kinase I
Position: -103 Score: 3.9 Sequence: TGAAATGAGCGAGATCGCATAT Locus tag: KPN_00854 Name: CKO_02295 Funciton: hypothetical protein
	KPN_00854	CKO_02295	hypothetical protein
Position: -117 Score: 4.4 Sequence: AAATGTGACCTGTGTCGCTAAA Locus tag: KPN_02738 Name: glk Funciton: glucokinase
	KPN_02738	glk	glucokinase
Position: -299 Score: 3.9 Sequence: CTTTGTGACCGCTTTCACGGAG Locus tag: KPN_04178 Name: glnA Funciton: glutamine synthetase Locus tag: KPN_04177 Name: glnL Funciton: nitrogen regulation protein NR(II) Locus tag: KPN_04176 Name: glnG Funciton: nitrogen regulation protein NR(I)
	KPN_04178	glnA	glutamine synthetase
	KPN_04177	glnL	nitrogen regulation protein NR(II)
	KPN_04176	glnG	nitrogen regulation protein NR(I)
Position: -165 Score: 4.3 Sequence: TACTGTGAAACATCGCACAATT Position: -115 Score: 3.8 Sequence: ATGTGAGCACGAAATCACATAA Locus tag: KPN_02647 Name: glpA Funciton: sn-glycerol-3-phosphate dehydrogenase subunit A Locus tag: KPN_02648 Name: glpB Funciton: Glycerol-3-phosphate dehydrogenase subunit B Locus tag: KPN_02649 Name: glpC Funciton: anaerobic glycerol-3-phosphate dehydrogenase subunit C
	KPN_02647	glpA	sn-glycerol-3-phosphate dehydrogenase subunit A
	KPN_02648	glpB	Glycerol-3-phosphate dehydrogenase subunit B
	KPN_02649	glpC	anaerobic glycerol-3-phosphate dehydrogenase subunit C
Position: -119 Score: 3.7 Sequence: ATATGTTACACCCATCACTTCA Position: -58 Score: 3.7 Sequence: TATAGTGAGCGATATCGAGCAT Locus tag: KPN_03792 Name: glpD Funciton: glycerol-3-phosphate dehydrogenase
	KPN_03792	glpD	glycerol-3-phosphate dehydrogenase
Position: -107 Score: 4.3 Sequence: TGAAGTGATGGGTGTAACATAT Locus tag: KPN_03791 Name: glpE Funciton: thiosulfate sulfurtransferase Locus tag: KPN_03790 Name: glpG Funciton: predicted intramembrane serine protease Locus tag: KPN_03789 Name: glpR2 Funciton: DNA-binding transcriptional repressor
	KPN_03791	glpE	thiosulfate sulfurtransferase
	KPN_03790	glpG	predicted intramembrane serine protease
	KPN_03789	glpR2	DNA-binding transcriptional repressor
Position: -145 Score: 3.7 Sequence: TTTCTTGACGAGACACACACAT Locus tag: KPN_04010 Name: glpF Funciton: facilitator for glycerol uptake Locus tag: KPN_04011 Name: glpK Funciton: glycerol kinase
	KPN_04010	glpF	facilitator for glycerol uptake
	KPN_04011	glpK	glycerol kinase
Position: -218 Score: 3.8 Sequence: TTGTTTGATTTCGAGCATATTC Position: -178 Score: 4.6 Sequence: TTATGTGATTTCGTGCTCACAT Position: -128 Score: 4.5 Sequence: AATTGTGCGATGTTTCACAGTA Locus tag: KPN_02646 Name: glpT Funciton: glycerol-3-phosphate transporter Locus tag: KPN_02645 Name: glpQ Funciton: glycerophosphoryl diester phosphodiesterase
	KPN_02646	glpT	glycerol-3-phosphate transporter
	KPN_02645	glpQ	glycerophosphoryl diester phosphodiesterase
Position: -129 Score: 4.7 Sequence: AAGTTTGAAGTAGATCACACAT Locus tag: KPN_03801 Name: gntK Funciton: gluconate kinase 1 Locus tag: KPN_03800 Name: gntU Funciton: Low-affinity gluconate transporter (Gluconate permease)
	KPN_03801	gntK	gluconate kinase 1
	KPN_03800	gntU	Low-affinity gluconate transporter (Gluconate permease)
Position: -232 Score: 4.2 Sequence: AAACGTGATCAATTTAACACCT Locus tag: KPN_04304 Name: hemC Funciton: porphobilinogen deaminase Locus tag: KPN_04303 Name: hemD Funciton: uroporphyrinogen-III synthase Locus tag: KPN_04302 Name: hemX Funciton: uroporphyrinogen III methylase Locus tag: KPN_04301 Name: hemY Funciton: HemY protein
	KPN_04304	hemC	porphobilinogen deaminase
	KPN_04303	hemD	uroporphyrinogen-III synthase
	KPN_04302	hemX	uroporphyrinogen III methylase
	KPN_04301	hemY	HemY protein
Position: -125 Score: 4.4 Sequence: TTGTGTTAATCCGATCACAAAA Locus tag: KPN_04789 Name: hpaG Funciton: 4-hydroxyphenylacetate catabolism Locus tag: KPN_04788 Name: hpaG Funciton: 4-hydroxyphenylacetate catabolism Locus tag: KPN_04787 Name: hpaE Funciton: 4-hydroxyphenylacetate catabolism Locus tag: KPN_04786 Name: hpaD Funciton: 4-hydroxyphenylacetate catabolism Locus tag: KPN_04785 Name: hpaF Funciton: 4-hydroxyphenylacetate catabolism
	KPN_04789	hpaG	4-hydroxyphenylacetate catabolism
	KPN_04788	hpaG	4-hydroxyphenylacetate catabolism
	KPN_04787	hpaE	4-hydroxyphenylacetate catabolism
	KPN_04786	hpaD	4-hydroxyphenylacetate catabolism
	KPN_04785	hpaF	4-hydroxyphenylacetate catabolism
Position: -183 Score: 5 Sequence: TTTTGTGATCGGATTAACACAA Locus tag: KPN_04790 Name: hpaR Funciton: 4-hydroxyphenylacetate catabolism
	KPN_04790	hpaR	4-hydroxyphenylacetate catabolism
Position: -134 Score: 5.4 Sequence: AAGTGTGATCGGAATCACAAAT Locus tag: KPN_00133 Name: hpt Funciton: hypoxanthine phosphoribosyltransferase
	KPN_00133	hpt	hypoxanthine phosphoribosyltransferase
Position: -124 Score: 4 Sequence: AAACGTGATTGCTGACGCAATA Locus tag: KPN_00795 Name: hutU Funciton: urocanate hydratase Locus tag: KPN_00796 Name: hutH Funciton: histidine ammonia-lyase
	KPN_00795	hutU	urocanate hydratase
	KPN_00796	hutH	histidine ammonia-lyase
Position: -103 Score: 3.9 Sequence: TGAAATGAGCGAGATCGCATAT Locus tag: KPN_00854 Name: CKO_02295 Funciton: hypothetical protein
	KPN_00854	CKO_02295	hypothetical protein
Position: -109 Score: 4.6 Sequence: TAATGTGAGTCAGCTCACTCAT Locus tag: KPN_pKPN3p05871 Name: lacZ Funciton: beta-D-galactosidase Locus tag: KPN_pKPN3p05870 Name: lacY Funciton: galactoside permease (lactose permease, M protein) (MFS family)
	KPN_pKPN3p05871	lacZ	beta-D-galactosidase
	KPN_pKPN3p05870	lacY	galactoside permease (lactose permease, M protein) (MFS family)
Position: -56 Score: 3.6 Sequence: TTGTGTAATACTTGTAACGCTA Locus tag: KPN_02134 Name: lpp Funciton: major outer membrane lipoprotein
	KPN_02134	lpp	major outer membrane lipoprotein
Position: -162 Score: 3.8 Sequence: AAGTGTGAGCCGACTGGCAAAA Locus tag: KPN_03507 Name: lsrA Funciton: ABC transporter related Locus tag: KPN_03506 Name: lsrC Funciton: putative ABC transport system permease protein Locus tag: KPN_03505 Name: lsrD Funciton: putative ABC transport system permease protein Locus tag: KPN_03504 Name: lsrB Funciton: putative ABC superfamily (peri_perm), sugar transport protein Locus tag: KPN_03503 Name: lsrF Funciton: hypothetical protein Locus tag: KPN_03502 Name: lsrG Funciton: autoinducer-2 (AI-2) modifying protein LsrG
	KPN_03507	lsrA	ABC transporter related
	KPN_03506	lsrC	putative ABC transport system permease protein
	KPN_03505	lsrD	putative ABC transport system permease protein
	KPN_03504	lsrB	putative ABC superfamily (peri_perm), sugar transport protein
	KPN_03503	lsrF	hypothetical protein
	KPN_03502	lsrG	autoinducer-2 (AI-2) modifying protein LsrG
Position: -100 Score: 4.7 Sequence: CTTTGTGATAGACATCACATCA Locus tag: KPN_00440 Name: maa Funciton: maltose O-acetyltransferase
	KPN_00440	maa	maltose O-acetyltransferase
Position: -167 Score: 3.8 Sequence: TTCTGTGCTCCAGGACGCAATA Position: -138 Score: 4.4 Sequence: TTTTGCAATGGAGATCACACAA Locus tag: KPN_04423 Name: malE Funciton: maltose ABC transporter periplasmic protein Locus tag: KPN_04422 Name: malF Funciton: ABC superfamily (membrane), maltose transport protein Locus tag: KPN_04421 Name: malG Funciton: ABC superfamily (membrane), maltose transport protein
	KPN_04423	malE	maltose ABC transporter periplasmic protein
	KPN_04422	malF	ABC superfamily (membrane), maltose transport protein
	KPN_04421	malG	ABC superfamily (membrane), maltose transport protein
Position: -254 Score: 4.5 Sequence: TTGTGTGATCTCCATTGCAAAA Position: -225 Score: 3.7 Sequence: TATTGCGTCCTGGAGCACAGAA Locus tag: KPN_04424 Name: malK Funciton: maltose/maltodextrin transporter ATP-binding protein Locus tag: KPN_04425 Name: lamB Funciton: maltoporin Locus tag: KPN_04426 Name: malM Funciton: maltose regulon periplasmic protein
	KPN_04424	malK	maltose/maltodextrin transporter ATP-binding protein
	KPN_04425	lamB	maltoporin
	KPN_04426	malM	maltose regulon periplasmic protein
Position: -133 Score: 4.4 Sequence: TATAGTGTTCAGGATCACACTT Locus tag: KPN_03787 Name: malP Funciton: maltodextrin phosphorylase Locus tag: KPN_03786 Name: malQ Funciton: 4-alpha-glucanotransferase
	KPN_03787	malP	maltodextrin phosphorylase
	KPN_03786	malQ	4-alpha-glucanotransferase
Position: -146 Score: 3.7 Sequence: AAATGCTAGCTTCGTCTCATTT Locus tag: KPN_03935 Name: malS Funciton: periplasmic alpha-amylase precursor
	KPN_03935	malS	periplasmic alpha-amylase precursor
Position: -142 Score: 4.4 Sequence: ATTTGTGACATAGAGCAAATTC Locus tag: KPN_03788 Name: malT Funciton: transcriptional regulator MalT
	KPN_03788	malT	transcriptional regulator MalT
Position: -163 Score: 3.8 Sequence: TTAACGGATCTTCATCACATTA Locus tag: KPN_02333 Name: manX Funciton: PTS enzyme IIAB, mannose-specific Locus tag: KPN_02334 Name: manY Funciton: PTS system, mannose/fructose/sorbose family, IIC subunit Locus tag: KPN_02335 Name: manZ Funciton: PTS enzyme IID, mannose-specific Locus tag: KPN_02336 Name: yobD Funciton: hypothetical protein
	KPN_02333	manX	PTS enzyme IIAB, mannose-specific
	KPN_02334	manY	PTS system, mannose/fructose/sorbose family, IIC subunit
	KPN_02335	manZ	PTS enzyme IID, mannose-specific
	KPN_02336	yobD	hypothetical protein
Position: -239 Score: 4.8 Sequence: ATTTGTGAGTAAATTCACAGTA Locus tag: KPN_02588 Name: mglB Funciton: Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3) Locus tag: KPN_02587 Name: mglA Funciton: Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17) Locus tag: KPN_02586 Name: mglC Funciton: Galactose/methyl galactoside ABC transport system, permease protein MglC (TC 3.A.1.2.3)
	KPN_02588	mglB	Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3)
	KPN_02587	mglA	Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17)
	KPN_02586	mglC	Galactose/methyl galactoside ABC transport system, permease protein MglC (TC 3.A.1.2.3)
Position: -296 Score: 4.3 Sequence: AAGTGTTAAATGGATCGCAAAA Locus tag: KPN_03036 Name: mltB Funciton: membrane-bound lytic murein transglycosylase B
	KPN_03036	mltB	membrane-bound lytic murein transglycosylase B
Position: -217 Score: 3.8 Sequence: AAAATTAATTCGTATCGCAAAT Position: -183 Score: 5 Sequence: TTTTGTGATAATTATCACCAAA Locus tag: KPN_00699 Name: nagB Funciton: Glucosamine-6-phosphate deaminase (EC 3.5.99.6) Locus tag: KPN_00698 Name: nagA Funciton: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25) Locus tag: KPN_00697 Name: nagC Funciton: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family Locus tag: KPN_00696 Name: nagD Funciton: Phosphatase NagD predicted to act in N-acetylglucosamine utilization subsystem
	KPN_00699	nagB	Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
	KPN_00698	nagA	N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
	KPN_00697	nagC	N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
	KPN_00696	nagD	Phosphatase NagD predicted to act in N-acetylglucosamine utilization subsystem
Position: -153 Score: 4.7 Sequence: TTTGGTGATAATTATCACAAAA Position: -119 Score: 3.6 Sequence: ATTTGCGATACGAATTAATTTT Locus tag: KPN_00700 Name: nagE Funciton: PTS system, N-acetylglucosamine-specific IIA component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)
	KPN_00700	nagE	PTS system, N-acetylglucosamine-specific IIA component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)
Position: -152 Score: 4.1 Sequence: AAACTTGATGCACATCAATTTT Locus tag: KPN_01106 Name: ndh Funciton: NADH dehydrogenase (EC 1.6.99.3)
	KPN_01106	ndh	NADH dehydrogenase (EC 1.6.99.3)
Position: -54 Score: 4 Sequence: AAGCGTGTTGCGTATCGCACAA Locus tag: KPN_03768 Name: nudE Funciton: ADP compounds hydrolase NudE (EC 3.6.1.-)
	KPN_03768	nudE	ADP compounds hydrolase NudE (EC 3.6.1.-)
Position: -49 Score: 4.2 Sequence: TAATGTTATTTTAAAAACATAA Locus tag: KPN_03396 Name: nupG Funciton: Nucleoside permease NupG
	KPN_03396	nupG	Nucleoside permease NupG
Position: -185 Score: 3.9 Sequence: ATGCCTGACAGAGTTCACACTT Locus tag: KPN_00986 Name: ompA Funciton: outer membrane protein A
	KPN_00986	ompA	outer membrane protein A
Position: -101 Score: 3.9 Sequence: CATTGCGATCGGTAGCAAAAAT Position: -45 Score: 4 Sequence: TAGTGTGATCTAAAACAGATCA Locus tag: KPN_01248 Name: ompW Funciton: outer membrane protein W
	KPN_01248	ompW	outer membrane protein W
Position: -242 Score: 3.7 Sequence: GAAAGCGATTACATTCACATTT Position: -138 Score: 3.7 Sequence: CTTCGTGACAGGAGTCACCGTT Locus tag: KPN_03773 Name: pck Funciton: Phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49)
	KPN_03773	pck	Phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49)
Position: -56 Score: 3.8 Sequence: TTGTGTGATACACGGTAAAAAA Locus tag: KPN_04321 Name: pldB Funciton: Lysophospholipase L2 (EC 3.1.1.5) Locus tag: KPN_04322 Name: yigL Funciton: Hydrolase (HAD superfamily)
	KPN_04321	pldB	Lysophospholipase L2 (EC 3.1.1.5)
	KPN_04322	yigL	Hydrolase (HAD superfamily)
Position: -189 Score: 3.9 Sequence: TATTGTGAAATGGGTTATCTTT Position: -158 Score: 5.3 Sequence: TAATGTGATCTGCATCACGCTT Locus tag: KPN_03749 Name: ppiA Funciton: Peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)
	KPN_03749	ppiA	Peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)
Position: -139 Score: 4.9 Sequence: AAATGTGATCTAAATCATCCTT Locus tag: KPN_04242 Name: fsaB Funciton: fructose 6-phosphate aldolase 2 Locus tag: KPN_04241 Name: gldA Funciton: Glycerol dehydrogenase (EC 1.1.1.6)
	KPN_04242	fsaB	fructose 6-phosphate aldolase 2
	KPN_04241	gldA	Glycerol dehydrogenase (EC 1.1.1.6)
Position: -155 Score: 4.4 Sequence: AAACGTGATAGCCGTCAAACAA Locus tag: KPN_01099 Name: ptsG Funciton: PTS system, glucose-specific IIB component (EC 2.7.1.69) / PTS system, glucose-specific IIC component (EC 2.7.1.69)
	KPN_01099	ptsG	PTS system, glucose-specific IIB component (EC 2.7.1.69) / PTS system, glucose-specific IIC component (EC 2.7.1.69)
Position: -206 Score: 4 Sequence: TTTTATGATTTGGTTCAAGTCT Locus tag: KPN_02762 Name: ptsH Funciton: PTS system phosphocarrier protein Locus tag: KPN_02763 Name: ptsI Funciton: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) Locus tag: KPN_02764 Name: crr Funciton: PTS system, glucose-specific IIA component (EC 2.7.1.69)
	KPN_02762	ptsH	PTS system phosphocarrier protein
	KPN_02763	ptsI	Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
	KPN_02764	crr	PTS system, glucose-specific IIA component (EC 2.7.1.69)
Position: -195 Score: 3.7 Sequence: TGTTTTTAATTCGGTCACACTA Locus tag: KPN_02421 Name: rcsA Funciton: Colanic acid capsular biosynthesis activation accesory protein RcsA, co-regulator with RcsB
	KPN_02421	rcsA	Colanic acid capsular biosynthesis activation accesory protein RcsA, co-regulator with RcsB
Position: -128 Score: 4.2 Sequence: AACTGTGATGTCCCTCACGGTC Locus tag: KPN_04213 Name: rhaB Funciton: rhamnulokinase Locus tag: KPN_04212 Name: rhaA Funciton: L-rhamnose isomerase Locus tag: KPN_04211 Name: rhaD Funciton: rhamnulose-1-phosphate aldolase
	KPN_04213	rhaB	rhamnulokinase
	KPN_04212	rhaA	L-rhamnose isomerase
	KPN_04211	rhaD	rhamnulose-1-phosphate aldolase
Position: -204 Score: 3.8 Sequence: GACCGTGAGGGACATCACAGTT Locus tag: KPN_04214 Name: rhaS Funciton: L-rhamnose operon regulatory protein RhaS Locus tag: KPN_04215 Name: rhaR Funciton: L-rhamnose operon transcriptional activator RhaR
	KPN_04214	rhaS	L-rhamnose operon regulatory protein RhaS
	KPN_04215	rhaR	L-rhamnose operon transcriptional activator RhaR
Position: -149 Score: 4.7 Sequence: TTTTGTGATGTAGAACAACTAA Locus tag: KPN_04216 Name: rhaT Funciton: L-rhamnose-proton symport
	KPN_04216	rhaT	L-rhamnose-proton symport
Position: -158 Score: 4.2 Sequence: ATTTGAGATCGCGATCACTGAT Locus tag: KPN_03139 Name: sdaC Funciton: Serine transporter Locus tag: KPN_03140 Name: sdaB Funciton: L-serine dehydratase 1
	KPN_03139	sdaC	Serine transporter
	KPN_03140	sdaB	L-serine dehydratase 1
Position: -214 Score: 4.6 Sequence: TTTGGTGACTTCTGTCACATTT Locus tag: KPN_03348 Name: serA Funciton: D-3-phosphoglycerate dehydrogenase
	KPN_03348	serA	D-3-phosphoglycerate dehydrogenase
Position: -150 Score: 4 Sequence: TTAGTTGTTCTACATCACAAAA Locus tag: KPN_04217 Name: sodA Funciton: Manganese superoxide dismutase (EC 1.15.1.1)
	KPN_04217	sodA	Manganese superoxide dismutase (EC 1.15.1.1)
Position: -292 Score: 3.6 Sequence: TAGGGTAATCTCGTTCTCGTTT Position: -234 Score: 4.2 Sequence: AATTGTGCGTGACTGCACAAAT Locus tag: KPN_02608 Name: spr Funciton: predicted peptidase, outer membrane lipoprotein
	KPN_02608	spr	predicted peptidase, outer membrane lipoprotein
Position: -135 Score: 4.4 Sequence: ATTTTTGATCGCGATCGCATCT Position: -94 Score: 5.1 Sequence: TTTTGTGATTAACATCATATAT Position: -46 Score: 3.6 Sequence: TTTTGTTAACGTTACCATAATT Locus tag: KPN_03262 Name: scrT Funciton: Sucrose permease, major facilitator superfamily
	KPN_03262	scrT	Sucrose permease, major facilitator superfamily
Position: -92 Score: 4.6 Sequence: TTTTGCGATCCATTTAACACTT Locus tag: KPN_03037 Name: srlA Funciton: PTS system, glucitol/sorbitol-specific IIC component (EC 2.7.1.69) Locus tag: KPN_03038 Name: srlE Funciton: PTS system, glucitol/sorbitol-specific IIB component and second of two IIC components (EC 2.7.1.69) Locus tag: KPN_03039 Name: srlB Funciton: PTS system, glucitol/sorbitol-specific IIA component (EC 2.7.1.69) Locus tag: KPN_03040 Name: srlD Funciton: Sorbitol-6-phosphate 2-dehydrogenase (EC 1.1.1.140) Locus tag: KPN_03042 Name: srlR Funciton: Transcriptional repressor for glucitol operon, DeoR family Locus tag: KPN_03043 Name: srlQ Funciton: Glucitol operon SrlQ protein
	KPN_03037	srlA	PTS system, glucitol/sorbitol-specific IIC component (EC 2.7.1.69)
	KPN_03038	srlE	PTS system, glucitol/sorbitol-specific IIB component and second of two IIC components (EC 2.7.1.69)
	KPN_03039	srlB	PTS system, glucitol/sorbitol-specific IIA component (EC 2.7.1.69)
	KPN_03040	srlD	Sorbitol-6-phosphate 2-dehydrogenase (EC 1.1.1.140)
	KPN_03042	srlR	Transcriptional repressor for glucitol operon, DeoR family
	KPN_03043	srlQ	Glucitol operon SrlQ protein
Position: -171 Score: 4.7 Sequence: CATTGTTATCTGCTTCACACTT Locus tag: KPN_00115 Name: araT Funciton: putative permease of the Na+:galactoside symporter family Locus tag: KPN_00114 Name: abfA Funciton: Alpha-L-arabinofuranosidase II precursor (EC 3.2.1.55)
	KPN_00115	araT	putative permease of the Na+:galactoside symporter family
	KPN_00114	abfA	Alpha-L-arabinofuranosidase II precursor (EC 3.2.1.55)
Position: -155 Score: 4.2 Sequence: AACTGTGATACACCTCCCAAAG Position: -53 Score: 3.6 Sequence: AGTTATAATGCGATTCGCAGAT Locus tag: KPN_01748 Name: CKO_00488 Funciton: LacI-family transcriptional regulator
	KPN_01748	CKO_00488	LacI-family transcriptional regulator
Position: -172 Score: 4.3 Sequence: TGTTGTGATACATCTCACGCCA Position: -121 Score: 4.2 Sequence: ATATGTGGAGTCGATCACCTAA Locus tag: KPN_04633 Name: CKO_03591 Funciton: hypothetical protein Locus tag: KPN_04634 Name: CKO_03590 Funciton: putative cytoplasmic protein Locus tag: KPN_04635 Name: CKO_03589 Funciton: putative cytoplasmic protein Locus tag: KPN_04636 Name: CKO_03588 Funciton: putative inner membrane protein Locus tag: KPN_04637 Name: CKO_03587 Funciton: putative inner membrane protein Locus tag: KPN_04638 Name: CKO_03586 Funciton: dihydroorotase Locus tag: KPN_04639 Name: CKO_03585 Funciton: hypothetical protein Locus tag: KPN_04640 Name: CKO_03584 Funciton: hypothetical protein
	KPN_04633	CKO_03591	hypothetical protein
	KPN_04634	CKO_03590	putative cytoplasmic protein
	KPN_04635	CKO_03589	putative cytoplasmic protein
	KPN_04636	CKO_03588	putative inner membrane protein
	KPN_04637	CKO_03587	putative inner membrane protein
	KPN_04638	CKO_03586	dihydroorotase
	KPN_04639	CKO_03585	hypothetical protein
	KPN_04640	CKO_03584	hypothetical protein
Position: -80 Score: 3.7 Sequence: TTTGGTTATGTACCTCATCAAT Locus tag: KPN_02798 Name: talA Funciton: Transaldolase (EC 2.2.1.2) Locus tag: KPN_02799 Name: tktB Funciton: Transketolase (EC 2.2.1.1)
	KPN_02798	talA	Transaldolase (EC 2.2.1.2)
	KPN_02799	tktB	Transketolase (EC 2.2.1.1)
Position: -82 Score: 4.6 Sequence: CTTTGTGAGAGCTCTCACATAA Position: -54 Score: 3.7 Sequence: AATTGCGATTTGTTACACTTTC Locus tag: KPN_02296 Name: tdcA Funciton: Threonine catabolic operon transcriptional activator TdcA Locus tag: KPN_02295 Name: tdcB Funciton: Threonine dehydratase, catabolic (EC 4.3.1.19) Locus tag: KPN_02294 Name: tdcC Funciton: L-threonine/L-serine permease Locus tag: KPN_02293 Name: tdcD Funciton: Propionate kinase (EC 2.7.2.15) / Acetate kinase (EC 2.7.2.1) Locus tag: KPN_02292 Name: tdcE Funciton: 2-ketobutyrate formate-lyase (EC 2.3.1.-) / Pyruvate formate-lyase (EC 2.3.1.54)
	KPN_02296	tdcA	Threonine catabolic operon transcriptional activator TdcA
	KPN_02295	tdcB	Threonine dehydratase, catabolic (EC 4.3.1.19)
	KPN_02294	tdcC	L-threonine/L-serine permease
	KPN_02293	tdcD	Propionate kinase (EC 2.7.2.15) / Acetate kinase (EC 2.7.2.1)
	KPN_02292	tdcE	2-ketobutyrate formate-lyase (EC 2.3.1.-) / Pyruvate formate-lyase (EC 2.3.1.54)
Position: -139 Score: 3.8 Sequence: AAGTGTGGCACAGATCTCAGAT Locus tag: KPN_00415 Name: tesB Funciton: Acyl-CoA thioesterase II (EC 3.1.2.-)
	KPN_00415	tesB	Acyl-CoA thioesterase II (EC 3.1.2.-)
Position: -131 Score: 3.8 Sequence: TTATGTGAAACAACACGTATTT Locus tag: KPN_00363 Name: tsx Funciton: Nucleoside-specific channel-forming protein Tsx precursor
	KPN_00363	tsx	Nucleoside-specific channel-forming protein Tsx precursor
Position: -143 Score: 5.2 Sequence: TAATGTGATGTGTATCACTATT Position: -91 Score: 4.1 Sequence: CTTGGTGACTATCATCACAAAA Locus tag: KPN_04327 Name: udp Funciton: Uridine phosphorylase (EC 2.4.2.3)
	KPN_04327	udp	Uridine phosphorylase (EC 2.4.2.3)
Position: -125 Score: 3.9 Sequence: AATTATTATCCAACTAACATAC Position: -94 Score: 3.7 Sequence: AGGTTTGAAGGAAGTCGCAATT Locus tag: KPN_00461 Name: ushA Funciton: UDP-sugar hydrolase (EC 3.6.1.45); 5'-nucleotidase (EC 3.1.3.5)
	KPN_00461	ushA	UDP-sugar hydrolase (EC 3.6.1.45); 5'-nucleotidase (EC 3.1.3.5)
Position: -251 Score: 3.8 Sequence: AAAGTTGAGAGCTGTCACAAAA Position: -129 Score: 4.4 Sequence: TTTATTGATCTAACTCACGAAA Locus tag: KPN_03520 Name: uxaC Funciton: Uronate isomerase (EC 5.3.1.12) Locus tag: KPN_03519 Name: uxaA Funciton: Altronate hydrolase (EC 4.2.1.7)
	KPN_03520	uxaC	Uronate isomerase (EC 5.3.1.12)
	KPN_03519	uxaA	Altronate hydrolase (EC 4.2.1.7)
Position: -234 Score: 4.1 Sequence: TTTTGCGAGCTGGCGCACGTTT Locus tag: KPN_03929 Name: xylA Funciton: Xylose isomerase (EC 5.3.1.5) Locus tag: KPN_03928 Name: xylB Funciton: Xylulose kinase (EC 2.7.1.17)
	KPN_03929	xylA	Xylose isomerase (EC 5.3.1.5)
	KPN_03928	xylB	Xylulose kinase (EC 2.7.1.17)
Position: -234 Score: 3.8 Sequence: AAATACGATCGCCGTCATAATT Locus tag: KPN_03930 Name: xylF Funciton: Xylose ABC transporter, periplasmic xylose-binding protein XylF Locus tag: KPN_03931 Name: xylG Funciton: D-xylose transport ATP-binding protein XylG Locus tag: KPN_03932 Name: xylH Funciton: Xylose ABC transporter, permease protein XylH Locus tag: KPN_03933 Name: xylR Funciton: Xylose activator XylR (AraC family)
	KPN_03930	xylF	Xylose ABC transporter, periplasmic xylose-binding protein XylF
	KPN_03931	xylG	D-xylose transport ATP-binding protein XylG
	KPN_03932	xylH	Xylose ABC transporter, permease protein XylH
	KPN_03933	xylR	Xylose activator XylR (AraC family)
Position: -69 Score: 3.8 Sequence: ATCTTTGACTCCCATCACCGAT Locus tag: KPN_00137 Name: yadI Funciton: predicted PTS Enzyme IIA
	KPN_00137	yadI	predicted PTS Enzyme IIA
Position: -57 Score: 3.8 Sequence: TTCTGTGACCGCCCCCACAACT Locus tag: KPN_00177 Name: cdaR Funciton: carbohydrate diacid regulator
	KPN_00177	cdaR	carbohydrate diacid regulator
Position: -208 Score: 3.7 Sequence: AAATGCGAGCTATTGCGCAAAG Locus tag: KPN_00238 Name: yafK Funciton: hypothetical protein
	KPN_00238	yafK	hypothetical protein
Position: -99 Score: 3.8 Sequence: ATCTGAGATCTGTGCCACACTT Locus tag: KPN_00416 Name: ybaY Funciton: Glycoprotein-polysaccharide metabolism
	KPN_00416	ybaY	Glycoprotein-polysaccharide metabolism
Position: -97 Score: 4.4 Sequence: AAGTGTGATTTCCATCCCCATA Locus tag: KPN_00663 Name: ybeD Funciton: hypothetical protein Locus tag: KPN_00662 Name: lipB Funciton: Octanoate-[acyl-carrier-protein]-protein-N-octanoyltransferase
	KPN_00663	ybeD	hypothetical protein
	KPN_00662	lipB	Octanoate-[acyl-carrier-protein]-protein-N-octanoyltransferase
Position: -56 Score: 4.2 Sequence: TTTTGTGACGTCTACTACACTA Locus tag: KPN_00818 Name: ybhP Funciton: hypothetical protein Locus tag: KPN_00817 Name: ybhO Funciton: Cardiolipin synthetase (EC 2.7.8.-) Locus tag: KPN_00816 Name: ybhN Funciton: hypothetical protein
	KPN_00818	ybhP	hypothetical protein
	KPN_00817	ybhO	Cardiolipin synthetase (EC 2.7.8.-)
	KPN_00816	ybhN	hypothetical protein
Position: -97 Score: 3.8 Sequence: TAGTGTAGTAGACGTCACAAAA Locus tag: KPN_00819 Name: ybhQ Funciton: putative inner membrane protein
	KPN_00819	ybhQ	putative inner membrane protein
Position: -224 Score: 3.6 Sequence: AAATGAAACGGTATTCAAAAAA Position: -118 Score: 4.7 Sequence: AATTGTTAAGCCCATCACAAAT Locus tag: KPN_00825 Name: KPN_00825 Funciton: putative bacterial regulatory protein, LysR Locus tag: KPN_00824 Name: ybiH Funciton: putative transcriptional regulator Locus tag: KPN_00823 Name: ybhG Funciton: hypothetical protein Locus tag: KPN_00822 Name: ybhF Funciton: ABC transporter-related protein Locus tag: KPN_00821 Name: ybhS Funciton: ABC-2 type transporter Locus tag: KPN_00820 Name: ybhR Funciton: ABC-2 type transporter
	KPN_00825	KPN_00825	putative bacterial regulatory protein, LysR
	KPN_00824	ybiH	putative transcriptional regulator
	KPN_00823	ybhG	hypothetical protein
	KPN_00822	ybhF	ABC transporter-related protein
	KPN_00821	ybhS	ABC-2 type transporter
	KPN_00820	ybhR	ABC-2 type transporter
Position: -52 Score: 4.1 Sequence: TACTGTGTTTTAGATCGCATTC Locus tag: KPN_01059 Name: ycdZ Funciton: hypothetical protein
	KPN_01059	ycdZ	hypothetical protein
Position: -227 Score: 4.8 Sequence: TAATGTGATCTATGTCACACGT Locus tag: KPN_01109 Name: ycfQ Funciton: hypothetical protein
	KPN_01109	ycfQ	hypothetical protein
Position: -95 Score: 4.9 Sequence: ACGTGTGACATAGATCACATTA Locus tag: KPN_01110 Name: ycfR Funciton: hypothetical protein
	KPN_01110	ycfR	hypothetical protein
Position: -174 Score: 4 Sequence: TATGGTGACTTAACTCACAGCA Locus tag: KPN_02310 Name: ycgB Funciton: hypothetical protein
	KPN_02310	ycgB	hypothetical protein
Position: -261 Score: 4.8 Sequence: TTACGTGATTTAGATCAAGTAT Locus tag: KPN_02198 Name: ychE Funciton: putative channel protein
	KPN_02198	ychE	putative channel protein
Position: -100 Score: 4.1 Sequence: TAATGTGATCGTGGACGCACTC Locus tag: KPN_02241 Name: ychH Funciton: membrane protein
	KPN_02241	ychH	membrane protein
Position: -75 Score: 3.8 Sequence: TTTTGCTATCTGGTTATCAAAT Locus tag: KPN_01950 Name: ydcI Funciton: putative transcriptional regulators, LysR family
	KPN_01950	ydcI	putative transcriptional regulators, LysR family
Position: -94 Score: 4.8 Sequence: AAATGAGACGCAGATCACAAAA Locus tag: KPN_01628 Name: sotB Funciton: Probable sugar efflux transporter
	KPN_01628	sotB	Probable sugar efflux transporter
Position: -99 Score: 4.3 Sequence: TTTTGTCATTTCGTTCACTTTT Position: -73 Score: 4.4 Sequence: TTTTGTGATTGATGTCATGCTT Locus tag: KPN_01995 Name: ydhP Funciton: hypothetical protein
	KPN_01995	ydhP	hypothetical protein
Position: -135 Score: 5.1 Sequence: AAACGTGATTTAAGTCACAATT Locus tag: KPN_01198 Name: msrB Funciton: methionine sulfoxide reductase B Locus tag: KPN_01199 Name: b1777 Funciton: conserved hypothetical protein
	KPN_01198	msrB	methionine sulfoxide reductase B
	KPN_01199	b1777	conserved hypothetical protein
Position: -134 Score: 3.6 Sequence: AAATACGACCCTGATCATGTAA Locus tag: KPN_02368 Name: hexR Funciton: Phosphogluconate repressor HexR, RpiR family
	KPN_02368	hexR	Phosphogluconate repressor HexR, RpiR family
Position: -204 Score: 3.8 Sequence: AAAGTTGTTTTGGATCACAGAA Locus tag: KPN_02614 Name: yejG Funciton: hypothetical protein
	KPN_02614	yejG	hypothetical protein
Position: -192 Score: 4.3 Sequence: TTTAGCGACACAGGTCACATTT Locus tag: KPN_02739 Name: yfeO Funciton: Chloride channel protein
	KPN_02739	yfeO	Chloride channel protein
Position: -112 Score: 3.6 Sequence: AAAATTGATTTATTGCATCTAT Locus tag: KPN_02755 Name: yfeR Funciton: transcriptional regulator, LysR family
	KPN_02755	yfeR	transcriptional regulator, LysR family
Position: -218 Score: 4 Sequence: TAATGTGACGTAGAGCAACCTC Position: -179 Score: 4 Sequence: TAATGTTAAAGCCCTCACATCA Locus tag: KPN_02804 Name: yffB Funciton: FIG138056: a glutathione-dependent thiol reductase Locus tag: KPN_02805 Name: dapE Funciton: N-succinyl-L,L-diaminopimelate desuccinylase (EC 3.5.1.18)
	KPN_02804	yffB	FIG138056: a glutathione-dependent thiol reductase
	KPN_02805	dapE	N-succinyl-L,L-diaminopimelate desuccinylase (EC 3.5.1.18)
Position: -88 Score: 5.6 Sequence: AAATGTGATTTATATCACACAT Locus tag: KPN_02919 Name: raiA Funciton: stationary phase translation inhibitor and ribosome stability factor
	KPN_02919	raiA	stationary phase translation inhibitor and ribosome stability factor
Position: -124 Score: 3.9 Sequence: TTTATTGATTTATATCAAGGAA Locus tag: KPN_02902 Name: grcA Funciton: Autonomous glycyl radical cofactor
	KPN_02902	grcA	Autonomous glycyl radical cofactor
Position: -271 Score: 3.6 Sequence: TAATGTGATTTAATGATAGAAT Position: -230 Score: 4.7 Sequence: ATATGTGAGAGTTATCACGAAT Locus tag: KPN_01606 Name: ygbI Funciton: Hypothetical transcriptional regulator ygbI
	KPN_01606	ygbI	Hypothetical transcriptional regulator ygbI
Position: -233 Score: 3.6 Sequence: TAATGTGATTTAATGATAGAAT Position: -192 Score: 4.7 Sequence: TTATGTGAGAGTTATCACGAAT Locus tag: KPN_pKPN4p07051 Name: ygbI Funciton: Hypothetical transcriptional regulator ygbI
	KPN_pKPN4p07051	ygbI	Hypothetical transcriptional regulator ygbI
Position: -91 Score: 5 Sequence: ATTCGTGATAACTCTCACATAT Locus tag: KPN_01605 Name: ygbJ Funciton: D-beta-hydroxybutyrate dehydrogenase (EC 1.1.1.30) Locus tag: KPN_01604 Name: ygbK Funciton: hypothetical protein
	KPN_01605	ygbJ	D-beta-hydroxybutyrate dehydrogenase (EC 1.1.1.30)
	KPN_01604	ygbK	hypothetical protein
Position: -230 Score: 3.6 Sequence: CGCTGTGAGCAGATTAACAAAA Locus tag: KPN_04419 Name: yhaM Funciton: hypothetical protein
	KPN_04419	yhaM	hypothetical protein
Position: -93 Score: 3.6 Sequence: ATTTGTTACATGAATCAGTAAA Position: -71 Score: 3.8 Sequence: ATATGTGAAGCATAGCGAGTTA Locus tag: KPN_03618 Name: elbB Funciton: sigma cross-reacting protein 27A (SCRP-27A) Locus tag: KPN_03617 Name: mtgA Funciton: monofunctional biosynthetic peptidoglycan transglycosylase
	KPN_03618	elbB	sigma cross-reacting protein 27A (SCRP-27A)
	KPN_03617	mtgA	monofunctional biosynthetic peptidoglycan transglycosylase
Position: -106 Score: 3.6 Sequence: TATTGTAACTATTAACGCACAA Position: -37 Score: 5 Sequence: TTTTGTGATGAGGGTCACGAAA Locus tag: KPN_03646 Name: yhcN Funciton: hypothetical protein
	KPN_03646	yhcN	hypothetical protein
Position: -116 Score: 5.2 Sequence: AAAAGTGATTTAGATCACACAT Position: -63 Score: 3.7 Sequence: TATTGTTAGCTACATAATAAAC Locus tag: KPN_03651 Name: yhcR Funciton: hypothetical protein Locus tag: KPN_03650 Name: aaeA Funciton: p-hydroxybenzoic acid efflux system component Locus tag: KPN_03649 Name: aaeB Funciton: p-hydroxybenzoic acid efflux system component
	KPN_03651	yhcR	hypothetical protein
	KPN_03650	aaeA	p-hydroxybenzoic acid efflux system component
	KPN_03649	aaeB	p-hydroxybenzoic acid efflux system component
Position: -140 Score: 5.3 Sequence: AAGCGTGATGCAGATCACATTA Position: -109 Score: 3.7 Sequence: AAAGATAACCCATTTCACAATA Locus tag: KPN_03750 Name: yhfC Funciton: Predicted purine nucleoside transporter, MFS superfamily
	KPN_03750	yhfC	Predicted purine nucleoside transporter, MFS superfamily
Position: -154 Score: 4.3 Sequence: TTGTGTGAAGCATTTCATAGAA Locus tag: KPN_03874 Name: yhjE Funciton: Inner membrane metabolite transport protein YhjE
	KPN_03874	yhjE	Inner membrane metabolite transport protein YhjE
Position: -143 Score: 3.7 Sequence: TGATGCGATTTAGCATACAAAA Locus tag: KPN_04013 Name: uraA1 Funciton: Xanthine permease
	KPN_04013	uraA1	Xanthine permease
Position: -55 Score: 4.9 Sequence: AATCGTGATCCTGCGCACAAAT Locus tag: KPN_03994 Name: yicG Funciton: Putative inner membrane protein
	KPN_03994	yicG	Putative inner membrane protein
Position: -56 Score: 4.1 Sequence: TTTTTTGAGCGGAATCGCGTTA Locus tag: KPN_04101 Name: yidA Funciton: Phosphatase YidA
	KPN_04101	yidA	Phosphatase YidA
Position: -226 Score: 4.1 Sequence: TTATATGAAAAAAATCAAAAAT Locus tag: KPN_04266 Name: yifB Funciton: magnesium chelatase family protein
	KPN_04266	yifB	magnesium chelatase family protein
Position: -143 Score: 5.4 Sequence: AAGTGTGATATAGTTCACACAA Locus tag: KPN_04460 Name: yjcB Funciton: hypothetical protein
	KPN_04460	yjcB	hypothetical protein
Position: -231 Score: 5.2 Sequence: TATTGTGAGCTTAATCACACAT Locus tag: KPN_04776 Name: cstA2 Funciton: Carbon starvation protein A paralog Locus tag: KPN_04775 Name: yjiX Funciton: hypothetical protein Locus tag: KPN_04774 Name: yjiA Funciton: ATP-binding protein
	KPN_04776	cstA2	Carbon starvation protein A paralog
	KPN_04775	yjiX	hypothetical protein
	KPN_04774	yjiA	ATP-binding protein
Position: -94 Score: 4 Sequence: TTTAGTGATTTTTGTTGCAAAT Locus tag: KPN_04857 Name: yjtD Funciton: RNA methyltransferase, TrmH family, group 1
	KPN_04857	yjtD	RNA methyltransferase, TrmH family, group 1
Position: -104 Score: 3.8 Sequence: AAATGTGCGGTAAATCACAAGG Locus tag: KPN_01574 Name: mlc Funciton: ROK family transcriptional regulatory protein
	KPN_01574	mlc	ROK family transcriptional regulatory protein
Position: -123 Score: 4.1 Sequence: TTCTGTGCTGTACATAAAATAA Locus tag: KPN_02574 Name: yohC Funciton: hypothetical protein
	KPN_02574	yohC	hypothetical protein
Position: -68 Score: 5 Sequence: TGATGTGATCGGTAGCACATTT Locus tag: KPN_02582 Name: yohJ Funciton: LrgA family protein Locus tag: KPN_02583 Name: yohK Funciton: LrgB family protein
	KPN_02582	yohJ	LrgA family protein
	KPN_02583	yohK	LrgB family protein
Position: -105 Score: 4.6 Sequence: CTTTGTGATTGGCTTCACTTTT Locus tag: KPN_03268 Name: yqeF Funciton: Acetyl-CoA acetyltransferase (EC 2.3.1.9)
	KPN_03268	yqeF	Acetyl-CoA acetyltransferase (EC 2.3.1.9)
Position: -82 Score: 3.9 Sequence: TTGTGTGATCTGCATCGCAGGG Locus tag: KPN_03349 Name: rpiA Funciton: Ribose 5-phosphate isomerase A (EC 5.3.1.6)
	KPN_03349	rpiA	Ribose 5-phosphate isomerase A (EC 5.3.1.6)
Position: -221 Score: 4.6 Sequence: TTGTGTGAAGTGATTCACATCT Locus tag: KPN_03680 Name: yrdA Funciton: carbonic anhydrase, family 3
	KPN_03680	yrdA	carbonic anhydrase, family 3
Position: -282 Score: 3.8 Sequence: TTGTGCGATACGCAACACGCTT Locus tag: KPN_03769 Name: igaA Funciton: IgaA: a membrane protein that prevents overactivation of the Rcs regulatory system
	KPN_03769	igaA	IgaA: a membrane protein that prevents overactivation of the Rcs regulatory system
Position: -225 Score: 3.8 Sequence: TTACATGATCAGGGTCGTATTT Locus tag: KPN_02367 Name: zwf Funciton: Glucose-6-phosphate 1-dehydrogenase (EC 1.1.1.49)
	KPN_02367	zwf	Glucose-6-phosphate 1-dehydrogenase (EC 1.1.1.49)
Position: -237 Score: 4.7 Sequence: ATACTTGATCTAAATCACGTAA Locus tag: KPN_02199 Name: adhE Funciton: Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
	KPN_02199	adhE	Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
Position: -84 Score: 3.5 Sequence: TTCTGTGCGCCACCTCACGCAC Locus tag: KPN_02591 Name: folE Funciton: GTP cyclohydrolase I Locus tag: KPN_02590 Name: yeiB Funciton: conserved inner membrane protein
	KPN_02591	folE	GTP cyclohydrolase I
	KPN_02590	yeiB	conserved inner membrane protein
Position: -160 Score: 3.3 Sequence: GATAACGATCTCGATCACAATC Position: -109 Score: 3.4 Sequence: CCGTGTGACCTCACTCACGCAG Position: -33 Score: 3.6 Sequence: TGACGTGCTGTAATTCTCTTAA Locus tag: KPN_02589 Name: galS Funciton: Mgl repressor and galactose ultrainduction factor GalS, HTH-type transcriptional regulator
	KPN_02589	galS	Mgl repressor and galactose ultrainduction factor GalS, HTH-type transcriptional regulator
Position: -88 Score: 3.6 Sequence: CTCTGTGAATTCGCGCACATAC Locus tag: KPN_02467 Name: sbmC Funciton: DNA gyrase inhibitor
	KPN_02467	sbmC	DNA gyrase inhibitor
Position: -105 Score: 3.3 Sequence: AATTGTTAACAATTTTGTAAAA Locus tag: KPN_00120 Name: lpdA Funciton: Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
	KPN_00120	lpdA	Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
Position: -199 Score: 4.3 Sequence: AAATGCGACCGCCATCAAAAAA Locus tag: KPN_03375 Name: metK Funciton: S-adenosylmethionine synthetase (EC 2.5.1.6)
	KPN_03375	metK	S-adenosylmethionine synthetase (EC 2.5.1.6)
Position: -75 Score: 3.7 Sequence: TTTTGCCAGTCGGCTCACACTT Locus tag: KPN_03508 Name: lsrR Funciton: LsrR, transcriptional repressor of lsr operon Locus tag: KPN_03509 Name: ydeV Funciton: putative kinase
	KPN_03508	lsrR	LsrR, transcriptional repressor of lsr operon
	KPN_03509	ydeV	putative kinase
Position: -246 Score: 3.3 Sequence: TTATGTGAATCACTTTGTTTAT Position: -177 Score: 4.4 Sequence: TTTTGTGATAATCTCCGCAAAA Locus tag: KPN_01468 Name: paaN Funciton: Phenylacetic acid degradation protein PaaN, ring-opening aldehyde dehydrogenase (EC 1.2.1.3)
	KPN_01468	paaN	Phenylacetic acid degradation protein PaaN, ring-opening aldehyde dehydrogenase (EC 1.2.1.3)
Position: -260 Score: 3.5 Sequence: TTTTGTAAACAGATTAACACCT Locus tag: KPN_00124 Name: acnB Funciton: Aconitate hydratase 2 (EC 4.2.1.3)
	KPN_00124	acnB	Aconitate hydratase 2 (EC 4.2.1.3)
Position: -239 Score: 3.4 Sequence: TAGCGTGACTTTTTTAATTAAT Locus tag: KPN_00602 Name: fepA Funciton: iron-enterobactin outer membrane transporter Locus tag: KPN_00601 Name: entD Funciton: 4'-phosphopantetheinyl transferase (EC 2.7.8.-) [enterobactin] siderophore
	KPN_00602	fepA	iron-enterobactin outer membrane transporter
	KPN_00601	entD	4'-phosphopantetheinyl transferase (EC 2.7.8.-) [enterobactin] siderophore
Position: -214 Score: 4 Sequence: AATAGTGATTCTGCGCAAATTG Locus tag: KPN_00402 Name: hupB Funciton: HU, DNA-binding transcriptional regulator, beta subunit
	KPN_00402	hupB	HU, DNA-binding transcriptional regulator, beta subunit
Position: -197 Score: 3.8 Sequence: CATTGTGATCGCGATGGCGTTA Position: -131 Score: 3.7 Sequence: TTTTGCGGAGATTATCACAAAA Locus tag: KPN_01469 Name: paaA Funciton: predicted multicomponent oxygenase/reductase subunit for phenylacetic acid degradation Locus tag: KPN_01470 Name: paaB Funciton: predicted multicomponent oxygenase/reductase subunit for phenylacetic acid degradation Locus tag: KPN_01471 Name: paaC Funciton: predicted multicomponent oxygenase/reductase subunit for phenylacetic acid degradation Locus tag: KPN_01472 Name: paaD Funciton: predicted multicomponent oxygenase/reductase subunit for phenylacetic acid degradation Locus tag: KPN_01473 Name: paaE Funciton: predicted multicomponent oxygenase/reductase subunit for phenylacetic acid degradation Locus tag: KPN_01474 Name: paaF Funciton: enoyl-CoA hydratase-isomerase Locus tag: KPN_01475 Name: paaG Funciton: enoyl-CoA hydratase Locus tag: KPN_01476 Name: paaH Funciton: 3-hydroxybutyryl-CoA dehydrogenase
	KPN_01469	paaA	predicted multicomponent oxygenase/reductase subunit for phenylacetic acid degradation
	KPN_01470	paaB	predicted multicomponent oxygenase/reductase subunit for phenylacetic acid degradation
	KPN_01471	paaC	predicted multicomponent oxygenase/reductase subunit for phenylacetic acid degradation
	KPN_01472	paaD	predicted multicomponent oxygenase/reductase subunit for phenylacetic acid degradation
	KPN_01473	paaE	predicted multicomponent oxygenase/reductase subunit for phenylacetic acid degradation
	KPN_01474	paaF	enoyl-CoA hydratase-isomerase
	KPN_01475	paaG	enoyl-CoA hydratase
	KPN_01476	paaH	3-hydroxybutyryl-CoA dehydrogenase
Position: -275 Score: 3.5 Sequence: TTTGGTAATACAAATAACTTTT Locus tag: KPN_03383 Name: csgD Funciton: DNA-binding transcriptional activator in two-component regulatory system
	KPN_03383	csgD	DNA-binding transcriptional activator in two-component regulatory system
Position: -145 Score: 3.7 Sequence: TTGTGTGACGGCGGCCGCGTTT Locus tag: KPN_00935 Name: serC Funciton: Phosphoserine aminotransferase (EC 2.6.1.52) Locus tag: KPN_00936 Name: aroA Funciton: 5-Enolpyruvylshikimate-3-phosphate synthase (EC 2.5.1.19)
	KPN_00935	serC	Phosphoserine aminotransferase (EC 2.6.1.52)
	KPN_00936	aroA	5-Enolpyruvylshikimate-3-phosphate synthase (EC 2.5.1.19)
Position: -81 Score: 4.1 Sequence: TTATGTGTTGCAAATCGCAACA Locus tag: KPN_02992 Name: prpR Funciton: Propionate catabolism operon regulatory protein PrpR
	KPN_02992	prpR	Propionate catabolism operon regulatory protein PrpR
Position: -147 Score: 4 Sequence: AGGTGTTAAATTGATCACGTTT Locus tag: KPN_04305 Name: cyaA Funciton: Adenylate cyclase (EC 4.6.1.1)
	KPN_04305	cyaA	Adenylate cyclase (EC 4.6.1.1)
Position: -153 Score: 4.8 Sequence: AAGCGTGATGTAGCTCACCCTT Locus tag: KPN_04069 Name: uhpT Funciton: Hexose phosphate transport protein UhpT
	KPN_04069	uhpT	Hexose phosphate transport protein UhpT
Position: -188 Score: 3.5 Sequence: TAATGTGAACTCCTCTGCATAC Locus tag: KPN_03742 Name: yhfA Funciton: hypothetical protein
	KPN_03742	yhfA	hypothetical protein
Position: -205 Score: 4.4 Sequence: TGTTGCGATTTGCAACACATAA Locus tag: KPN_02991 Name: aldB Funciton: Aldehyde dehydrogenase B (EC 1.2.1.22)
	KPN_02991	aldB	Aldehyde dehydrogenase B (EC 1.2.1.22)
Position: -88 Score: 3.4 Sequence: TATTTTTCTGTAATTCGAACAT Locus tag: KPN_03813 Name: ugpB Funciton: Glycerol-3-phosphate ABC transporter, periplasmic glycerol-3-phosphate-binding protein (TC 3.A.1.1.3) Locus tag: KPN_03812 Name: ugpA Funciton: SN-glycerol-3-phosphate transport system permease protein UgpA (TC 3.A.1.1.3) Locus tag: KPN_03811 Name: ugpE Funciton: SN-glycerol-3-phosphate transport system permease protein UgpE (TC 3.A.1.1.3) Locus tag: KPN_03810 Name: ugpC Funciton: SN-glycerol-3-phosphate transport ATP-binding protein UgpC (TC 3.A.1.1.3) Locus tag: KPN_03809 Name: ugpQ Funciton: Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46)
	KPN_03813	ugpB	Glycerol-3-phosphate ABC transporter, periplasmic glycerol-3-phosphate-binding protein (TC 3.A.1.1.3)
	KPN_03812	ugpA	SN-glycerol-3-phosphate transport system permease protein UgpA (TC 3.A.1.1.3)
	KPN_03811	ugpE	SN-glycerol-3-phosphate transport system permease protein UgpE (TC 3.A.1.1.3)
	KPN_03810	ugpC	SN-glycerol-3-phosphate transport ATP-binding protein UgpC (TC 3.A.1.1.3)
	KPN_03809	ugpQ	Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46)
Position: -125 Score: 4 Sequence: TATTGCGGCGCGCGTCACATTT Position: -88 Score: 3.3 Sequence: TGTTGTGATTATTTTTGATTAT Locus tag: KPN_04586 Name: ulaA Funciton: Ascorbate-specific PTS system, EIIC component Locus tag: KPN_04587 Name: ulaB Funciton: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69) Locus tag: KPN_04588 Name: ulaC Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-) Locus tag: KPN_04589 Name: ulaD Funciton: 3-keto-L-gulonate-6-phosphate decarboxylase UlaD (EC 4.1.1.85) (L-ascorbate utilization protein D) Locus tag: KPN_04590 Name: ulaE Funciton: L-ribulose-5-phosphate 3-epimerase UlaE (EC 5.1.3.22) (L-ascorbate utilization protein E) Locus tag: KPN_04591 Name: ulaF Funciton: L-ribulose-5-phosphate 4-epimerase UlaF (EC 5.1.3.4) (L-ascorbate utilization protein F)
	KPN_04586	ulaA	Ascorbate-specific PTS system, EIIC component
	KPN_04587	ulaB	Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
	KPN_04588	ulaC	Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
	KPN_04589	ulaD	3-keto-L-gulonate-6-phosphate decarboxylase UlaD (EC 4.1.1.85) (L-ascorbate utilization protein D)
	KPN_04590	ulaE	L-ribulose-5-phosphate 3-epimerase UlaE (EC 5.1.3.22) (L-ascorbate utilization protein E)
	KPN_04591	ulaF	L-ribulose-5-phosphate 4-epimerase UlaF (EC 5.1.3.4) (L-ascorbate utilization protein F)
Position: -105 Score: 3.2 Sequence: TGATATAACCTGCATCGCTAAT Locus tag: KPN_00010 Name: proP Funciton: L-Proline/Glycine betaine transporter ProP
	KPN_00010	proP	L-Proline/Glycine betaine transporter ProP
Position: -179 Score: 3.4 Sequence: AAACGTGATTTACCGCCTGAAT Locus tag: KPN_04382 Name: hupA Funciton: DNA-binding protein HU-alpha (HU-2)
	KPN_04382	hupA	DNA-binding protein HU-alpha (HU-2)
Position: -208 Score: 4.9 Sequence: TTTTGTGATCATCATCACTAAA Position: -164 Score: 5.2 Sequence: TCATGTGATCCAAATCACATAA Position: -115 Score: 3.4 Sequence: TTCAGTGCCAGATTTCGCACTA Locus tag: KPN_03942 Name: mtlA Funciton: PTS system, mannitol-specific IIC component (EC 2.7.1.69) / PTS system, mannitol-specific IIB component (EC 2.7.1.69) / PTS system, mannitol-specific IIA component (EC 2.7.1.69) Locus tag: KPN_03943 Name: mtlD Funciton: Mannitol-1-phosphate 5-dehydrogenase (EC 1.1.1.17) Locus tag: KPN_03944 Name: mtlR Funciton: Mannitol operon repressor
	KPN_03942	mtlA	PTS system, mannitol-specific IIC component (EC 2.7.1.69) / PTS system, mannitol-specific IIB component (EC 2.7.1.69) / PTS system, mannitol-specific IIA component (EC 2.7.1.69)
	KPN_03943	mtlD	Mannitol-1-phosphate 5-dehydrogenase (EC 1.1.1.17)
	KPN_03944	mtlR	Mannitol operon repressor

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Crp in Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --