Regulon of Crp in Escherichia coli str. K-12 substr. MG1655

Properties
Regulator type:	Transcription factor
TF locus tag:	b3357
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Carbon catabolism
Effector:	Cyclic 3',5'-AMP
Regulog:	Crp - Enterobacteriales
Statistics of regulated genes:
- Genes	473
- Operons	245
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2301 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - CRP
By effector - Cyclic 3',5'-AMP
By pathway - Carbon catabolism

Regulated operons
	Locus Tag	Name	Function
Position: -154 Score: 3.3 Sequence: TACATTGATGTACTGCATGTAT Position: -136 Score: 3.3 Sequence: GTATGCAAAGGACGTCACATTA Locus tag: b3357 Name: crp Funciton: cyclic AMP receptor protein
	b3357	crp	cyclic AMP receptor protein
Position: -269 Score: 4.8 Sequence: ATAAGTGACCGAAATCACACTT Position: -247 Score: 3.9 Sequence: AAAAATGATCTAAAACAAAATT Locus tag: b2344 Name: fadL Funciton: Long-chain fatty acid transport protein
	b2344	fadL	Long-chain fatty acid transport protein
Position: -104 Score: 3.5 Sequence: TTCTGTGACGCTTGCCAACATT Locus tag: b2535 Name: csiE Funciton: Stationary phase inducible protein CsiE
	b2535	csiE	Stationary phase inducible protein CsiE
Position: -270 Score: 4.2 Sequence: TAATCTGATTATCATCAAACAT Locus tag: b2741 Name: rpoS Funciton: RNA polymerase sigma factor RpoS
	b2741	rpoS	RNA polymerase sigma factor RpoS
Position: -37 Score: 5.3 Sequence: TTATGTGATCTAAATCACTTTT Locus tag: b3243 Name: aaeR Funciton: LysR-family transcriptional regulator
	b3243	aaeR	LysR-family transcriptional regulator
Position: -100 Score: 4.1 Sequence: TTGCGTGATCTGTCGCCCAAAT Locus tag: b4069 Name: acs Funciton: acetyl-coenzyme A synthetase Locus tag: b4068 Name: yjcH Funciton: membrane protein Locus tag: b4067 Name: actP Funciton: acetate permease
	b4069	acs	acetyl-coenzyme A synthetase
	b4068	yjcH	membrane protein
	b4067	actP	acetate permease
Position: -104 Score: 5 Sequence: AATTGCGATCTAAATCAAATTA Locus tag: b3072 Name: aer Funciton: aerotaxis sensor receptor, senses cellular redox state or proton motive force
	b3072	aer	aerotaxis sensor receptor, senses cellular redox state or proton motive force
Position: -112 Score: 4.3 Sequence: TTTTATGAAGCCCTTCACAGAA Locus tag: b1415 Name: aldA Funciton: aldehyde dehydrogenase A
	b1415	aldA	aldehyde dehydrogenase A
Position: -125 Score: 4 Sequence: TTTTGTTACCTGCCTCTAACTT Locus tag: b2957 Name: ansB Funciton: periplasmic L-asparaginase II
	b2957	ansB	periplasmic L-asparaginase II
Position: -130 Score: 3.6 Sequence: CATCCTGCTTTTCATCACAAAA Position: -57 Score: 4 Sequence: TTTTGCAACAAATCTCACAATA Locus tag: b4055 Name: aphA Funciton: acid phosphatase/phosphotransferase
	b4055	aphA	acid phosphatase/phosphotransferase
Position: -131 Score: 3.9 Sequence: TTATTTGCACGGCGTCACACTT Locus tag: b0063 Name: araB Funciton: L-ribulokinase Locus tag: b0062 Name: araA Funciton: L-arabinose isomerase Locus tag: b0061 Name: araD Funciton: L-ribulose-5-phosphate 4-epimerase
	b0063	araB	L-ribulokinase
	b0062	araA	L-arabinose isomerase
	b0061	araD	L-ribulose-5-phosphate 4-epimerase
Position: -229 Score: 4.4 Sequence: AAGTGTGACGCCGTGCAAATAA Locus tag: b0064 Name: araC Funciton: DNA-binding transcriptional dual regulator
	b0064	araC	DNA-binding transcriptional dual regulator
Position: -131 Score: 4.4 Sequence: AATTGGAATATCCATCACATAA Locus tag: b2841 Name: araE Funciton: sugar transporter
	b2841	araE	sugar transporter
Position: -163 Score: 4.2 Sequence: CGATGTGATATTGCTCTCCTAT Locus tag: b1901 Name: araF Funciton: L-arabinose-binding periplasmic protein Locus tag: b1900 Name: araG Funciton: L-arabinose transporter ATP-binding protein Locus tag: b4460 Name: araH Funciton: L-arabinose transporter permease protein
	b1901	araF	L-arabinose-binding periplasmic protein
	b1900	araG	L-arabinose transporter ATP-binding protein
	b4460	araH	L-arabinose transporter permease protein
Position: -66 Score: 3.7 Sequence: TAGTGTATTTTTATTCATAAAT Locus tag: b3957 Name: argE Funciton: acetylornithine deacetylase
	b3957	argE	acetylornithine deacetylase
Position: -106 Score: 4.3 Sequence: AGGTGTGACACACCTCGCACTT Position: -64 Score: 4 Sequence: TATCGTGATGCGCATCACTTCC Locus tag: b1704 Name: aroH Funciton: phospho-2-dehydro-3-deoxyheptonate aldolase
	b1704	aroH	phospho-2-dehydro-3-deoxyheptonate aldolase
Position: -177 Score: 4.2 Sequence: TCAGGTGACCGGTTTCACAAAT Locus tag: b2715 Name: ascF Funciton: hypothetical protein Locus tag: b2716 Name: ascB Funciton: 6-phospho-beta-glucosidase
	b2715	ascF	hypothetical protein
	b2716	ascB	6-phospho-beta-glucosidase
Position: -206 Score: 4.5 Sequence: AGCGGTGATCTATTTCACAAAT Position: -156 Score: 4.2 Sequence: TAAAGTGATCCAGATTACGGTA Locus tag: b4139 Name: aspA Funciton: aspartate ammonia-lyase Locus tag: b4138 Name: dcuA Funciton: anaerobic C-4-dicarboxylate symporter
	b4139	aspA	aspartate ammonia-lyase
	b4138	dcuA	anaerobic C-4-dicarboxylate symporter
Position: -263 Score: 4.8 Sequence: ATATGTGATCTGAAGCACGCTT Locus tag: b3739 Name: atpI Funciton: ATP synthase subunit I Locus tag: b3738 Name: atpB Funciton: ATP synthase subunit A Locus tag: b3737 Name: atpE Funciton: ATP synthase subunit C Locus tag: b3736 Name: atpF Funciton: ATP synthase subunit B Locus tag: b3735 Name: atpH Funciton: ATP synthase subunit D Locus tag: b3734 Name: atpA Funciton: ATP synthase subunit A Locus tag: b3733 Name: atpG Funciton: ATP synthase subunit C Locus tag: b3732 Name: atpD Funciton: ATP synthase subunit B Locus tag: b3731 Name: atpC Funciton: ATP synthase epsilon subunit
	b3739	atpI	ATP synthase subunit I
	b3738	atpB	ATP synthase subunit A
	b3737	atpE	ATP synthase subunit C
	b3736	atpF	ATP synthase subunit B
	b3735	atpH	ATP synthase subunit D
	b3734	atpA	ATP synthase subunit A
	b3733	atpG	ATP synthase subunit C
	b3732	atpD	ATP synthase subunit B
	b3731	atpC	ATP synthase epsilon subunit
Position: -287 Score: 4.6 Sequence: TGGTGTGATCAGGCGCACATTA Locus tag: b1963 Name: b1963 Funciton: orf, hypothetical protein Locus tag: b1962 Name: yedJ Funciton: hypothetical protein
	b1963	b1963	orf, hypothetical protein
	b1962	yedJ	hypothetical protein
Position: -103 Score: 4.6 Sequence: CTTAGTGATCTACCTCACCTTT Locus tag: b2462 Name: b2462 Funciton: putative carboxysome structural protein, ethanol utilization Locus tag: b2461 Name: eutP Funciton: putative ethanolamine utilization protein Locus tag: b2460 Name: eutQ Funciton: hypothetical protein Locus tag: b2459 Name: eutT Funciton: predicted cobalamin adenosyltransferase in ethanolamine utilization Locus tag: b2458 Name: eutI Funciton: predicted phosphotransacetylase subunit Locus tag: b2457 Name: cchA Funciton: detox protein Locus tag: b2456 Name: cchB Funciton: hypothetical protein Locus tag: b2455 Name: eutE Funciton: ethanolamine utilization protein Locus tag: b2454 Name: eutJ Funciton: ethanolamine utilization protein Locus tag: b2453 Name: eutG Funciton: ethanolamine utilization enzyme
	b2462	b2462	putative carboxysome structural protein, ethanol utilization
	b2461	eutP	putative ethanolamine utilization protein
	b2460	eutQ	hypothetical protein
	b2459	eutT	predicted cobalamin adenosyltransferase in ethanolamine utilization
	b2458	eutI	predicted phosphotransacetylase subunit
	b2457	cchA	detox protein
	b2456	cchB	hypothetical protein
	b2455	eutE	ethanolamine utilization protein
	b2454	eutJ	ethanolamine utilization protein
	b2453	eutG	ethanolamine utilization enzyme
Position: -189 Score: 4.2 Sequence: TTTTGCGATAACCCCCACATTT Position: -72 Score: 4.4 Sequence: ATTTGAGATTCAACTCTCAAAT Locus tag: b3570 Name: bax Funciton: hypothetical protein
	b3570	bax	hypothetical protein
Position: -202 Score: 3.7 Sequence: AACTGCGAGCATGGTCATATTT Position: -185 Score: 3.6 Sequence: TATTTTTATCAATAGCGCATTG Locus tag: b3723 Name: arbG Funciton: transcriptional antiterminator, BglG
	b3723	arbG	transcriptional antiterminator, BglG
Position: -278 Score: 4.3 Sequence: TATTGTTTTATGGATCACCAAT Position: -246 Score: 3.6 Sequence: AGATGTTATTTTTTACTCACAA Position: -158 Score: 5.2 Sequence: AAATGTGATACCAATCACAGAA Locus tag: b0040 Name: caiT Funciton: L-carnitine/gamma-butyrobetaine antiporter Locus tag: b0039 Name: caiA Funciton: crotonobetainyl-CoA dehydrogenase Locus tag: b0038 Name: caiB Funciton: crotonobetainyl-CoA:carnitine CoA-transferase Locus tag: b0037 Name: caiC2 Funciton: crotonobetaine/carnitine-CoA ligase Locus tag: b0036 Name: caiD Funciton: carnitinyl-CoA dehydratase Locus tag: b0035 Name: caiE Funciton: hypothetical protein
	b0040	caiT	L-carnitine/gamma-butyrobetaine antiporter
	b0039	caiA	crotonobetainyl-CoA dehydrogenase
	b0038	caiB	crotonobetainyl-CoA:carnitine CoA-transferase
	b0037	caiC2	crotonobetaine/carnitine-CoA ligase
	b0036	caiD	carnitinyl-CoA dehydratase
	b0035	caiE	hypothetical protein
Position: -128 Score: 4.3 Sequence: ATTTGCGATGCGTCGCGCATTT Position: -78 Score: 5.1 Sequence: TAATGAGATTCAGATCACATAT Locus tag: b2143 Name: cdd Funciton: cytidine deaminase
	b2143	cdd	cytidine deaminase
Position: -80 Score: 3.8 Sequence: TTCTGCGAGATTTCTCACAAAG Locus tag: b1661 Name: cfa Funciton: cyclopropane fatty acyl phospholipid synthase
	b1661	cfa	cyclopropane fatty acyl phospholipid synthase
Position: -201 Score: 3.7 Sequence: AAATGTGAAGAGGGTCATAACC Locus tag: b1738 Name: chbB Funciton: N,N'-diacetylchitobiose-specific PTS system , EIIB component Locus tag: b1737 Name: chbC Funciton: N,N'-diacetylchitobiose-specific PTS system , EIIC component Locus tag: b1736 Name: chbA Funciton: N,N'-diacetylchitobiose-specific PTS system transporter subunit IIA Locus tag: b1735 Name: chbR Funciton: DNA-binding transcriptional dual regulator Locus tag: b1734 Name: chbF Funciton: 6-phospho-beta-glucosidase (cellobiose-6-phosphate hydrolase) Locus tag: b1733 Name: chbG Funciton: hypothetical protein
	b1738	chbB	N,N'-diacetylchitobiose-specific PTS system , EIIB component
	b1737	chbC	N,N'-diacetylchitobiose-specific PTS system , EIIC component
	b1736	chbA	N,N'-diacetylchitobiose-specific PTS system transporter subunit IIA
	b1735	chbR	DNA-binding transcriptional dual regulator
	b1734	chbF	6-phospho-beta-glucosidase (cellobiose-6-phosphate hydrolase)
	b1733	chbG	hypothetical protein
Position: -165 Score: 4.2 Sequence: ACATGTGAGCGAGATCAAATTC Locus tag: b2508 Name: guaB Funciton: inosine-5'-monophosphate dehydrogenase Locus tag: b2507 Name: guaA Funciton: bifunctional GMP synthase/glutamine amidotransferase protein
	b2508	guaB	inosine-5'-monophosphate dehydrogenase
	b2507	guaA	bifunctional GMP synthase/glutamine amidotransferase protein
Position: -164 Score: 4 Sequence: AAATTTGAAGCAGTTAACGCTA Locus tag: b0881 Name: clpS Funciton: ATP-dependent Clp protease adaptor protein Locus tag: b0882 Name: clpA Funciton: ATP-dependent CLP protease ATP-binding subunit
	b0881	clpS	ATP-dependent Clp protease adaptor protein
	b0882	clpA	ATP-dependent CLP protease ATP-binding subunit
Position: -118 Score: 3.8 Sequence: AACTGTGATAGTGTCATCATTT Position: -85 Score: 3.8 Sequence: AATTGTGGCATTCTTCACTGTT Locus tag: b4213 Name: cpdB Funciton: 2',3'-cyclic-nucleotide 2'-phosphodiesterase precursor
	b4213	cpdB	2',3'-cyclic-nucleotide 2'-phosphodiesterase precursor
Position: -81 Score: 3.7 Sequence: TATTGAGATTTTGTTCTTAATC Locus tag: b4397 Name: creA Funciton: hypothetical protein Locus tag: b4398 Name: creB Funciton: DNA-binding response regulator CreB Locus tag: b4399 Name: creC Funciton: sensory histidine kinase CreC Locus tag: b4400 Name: creD Funciton: tolerance to colicin E2
	b4397	creA	hypothetical protein
	b4398	creB	DNA-binding response regulator CreB
	b4399	creC	sensory histidine kinase CreC
	b4400	creD	tolerance to colicin E2
Position: -180 Score: 4 Sequence: TAGCGTTAACTGCTTCAAATTT Locus tag: b0880 Name: cspD Funciton: cold shock-like protein
	b0880	cspD	cold shock-like protein
Position: -114 Score: 4 Sequence: TAACGCGACTTTTATCACTTTT Locus tag: b0623 Name: cspE Funciton: cold shock protein E
	b0623	cspE	cold shock protein E
Position: -139 Score: 3.7 Sequence: CGGAGTGATCGAGTTAACATTG Locus tag: b0598 Name: cstA2 Funciton: carbon starvation protein Locus tag: b4512 Name: ybdD Funciton: hypothetical protein
	b0598	cstA2	carbon starvation protein
	b4512	ybdD	hypothetical protein
Position: -198 Score: 4.7 Sequence: TTTTGTGAGCTGTTTCGCGTTA Locus tag: b4208 Name: cycA2 Funciton: D-alanine/D-serine/glycine permease
	b4208	cycA2	D-alanine/D-serine/glycine permease
Position: -300 Score: 3.6 Sequence: TAAATTGTTCTCGATCAAATTG Position: -255 Score: 3.6 Sequence: TAAATTGATCACCGTCGAAAAA Locus tag: b0733 Name: cydA Funciton: cytochrome d terminal oxidase, polypeptide subunit I Locus tag: b0734 Name: cydB Funciton: cytochrome D ubiquinol oxidase subunit II Locus tag: b4515 Name: ybgT Funciton: hypothetical protein Locus tag: b0735 Name: ybgE Funciton: hypothetical protein
	b0733	cydA	cytochrome d terminal oxidase, polypeptide subunit I
	b0734	cydB	cytochrome D ubiquinol oxidase subunit II
	b4515	ybgT	hypothetical protein
	b0735	ybgE	hypothetical protein
Position: -245 Score: 3.8 Sequence: ATAATTGTTTTATTTCACATTG Locus tag: b0432 Name: cyoA Funciton: cytochrome o ubiquinol oxidase subunit II Locus tag: b0431 Name: cyoB Funciton: cytochrome o ubiquinol oxidase subunit I Locus tag: b0430 Name: cyoC Funciton: cytochrome o ubiquinol oxidase subunit III Locus tag: b0429 Name: cyoD Funciton: cytochrome o ubiquinol oxidase subunit IV Locus tag: b0428 Name: cyoE Funciton: protoheme IX farnesyltransferase
	b0432	cyoA	cytochrome o ubiquinol oxidase subunit II
	b0431	cyoB	cytochrome o ubiquinol oxidase subunit I
	b0430	cyoC	cytochrome o ubiquinol oxidase subunit III
	b0429	cyoD	cytochrome o ubiquinol oxidase subunit IV
	b0428	cyoE	protoheme IX farnesyltransferase
Position: -126 Score: 3.6 Sequence: AACAGTGAAGAATGCCACAATT Locus tag: b4214 Name: cysQ Funciton: PAPS (adenosine 3'-phosphate 5'-phosphosulfate) 3'(2'),5'-bisphosphate nucleotidase
	b4214	cysQ	PAPS (adenosine 3'-phosphate 5'-phosphosulfate) 3'(2'),5'-bisphosphate nucleotidase
Position: -128 Score: 3.9 Sequence: AAATTCAATATTCATCACACTT Locus tag: b3934 Name: cytR Funciton: transcriptional repressor
	b3934	cytR	transcriptional repressor
Position: -99 Score: 4.3 Sequence: AAATGAGAGGGTAGTCACATTT Locus tag: b2010 Name: dacD2 Funciton: D-alanyl-D-alanine carboxypeptidase
	b2010	dacD2	D-alanyl-D-alanine carboxypeptidase
Position: -116 Score: 4.7 Sequence: AGATGTGAGCCAGCTCACCATA Locus tag: b1189 Name: dadA Funciton: D-amino acid dehydrogenase small subunit Locus tag: b1190 Name: dadX Funciton: alanine racemase
	b1189	dadA	D-amino acid dehydrogenase small subunit
	b1190	dadX	alanine racemase
Position: -143 Score: 4.1 Sequence: TTGTGCGAGCCAGCTCAAACTT Locus tag: b3528 Name: dctA Funciton: C4-dicarboxylate transport protein
	b3528	dctA	C4-dicarboxylate transport protein
Position: -149 Score: 4.6 Sequence: TTATTTGAACCAGATCGCATTA Position: -96 Score: 4.5 Sequence: AATTGTGATGTGTATCGAAGTG Locus tag: b4381 Name: deoC Funciton: 2-deoxyribose-5-phosphate aldolase Locus tag: b4382 Name: deoA Funciton: thymidine phosphorylase Locus tag: b4383 Name: deoB Funciton: phosphopentomutase Locus tag: b4384 Name: deoD Funciton: purine nucleoside phosphorylase
	b4381	deoC	2-deoxyribose-5-phosphate aldolase
	b4382	deoA	thymidine phosphorylase
	b4383	deoB	phosphopentomutase
	b4384	deoD	purine nucleoside phosphorylase
Position: -154 Score: 4.2 Sequence: TTTTGTGATCTAAATTGTAGTA Locus tag: b4479 Name: dgoR Funciton: GntR domain protein Locus tag: b3693 Name: dgoK Funciton: 2-dehydro-3-deoxygalactonokinase Locus tag: b4477 Name: dgoA2 Funciton: 2-dehydro-3-deoxy-6-phosphogalactonate aldolase Locus tag: b4478 Name: dgoA1 Funciton: Mandelate racemase/muconate lactonizing enzyme, N-terminal domain protein Locus tag: b3691 Name: dgoT Funciton: D-galactonate transport
	b4479	dgoR	GntR domain protein
	b3693	dgoK	2-dehydro-3-deoxygalactonokinase
	b4477	dgoA2	2-dehydro-3-deoxy-6-phosphogalactonate aldolase
	b4478	dgoA1	Mandelate racemase/muconate lactonizing enzyme, N-terminal domain protein
	b3691	dgoT	D-galactonate transport
Position: -115 Score: 3.9 Sequence: TGGAGTGATTTACATCTAAAAA Position: -85 Score: 4.6 Sequence: AATTGAGATATGGTTCACTTTA Locus tag: b2364 Name: dsdC Funciton: DNA-binding transcriptional dual regulator
	b2364	dsdC	DNA-binding transcriptional dual regulator
Position: -154 Score: 4.4 Sequence: TAAAGTGAACCATATCTCAATT Locus tag: b2365 Name: dsdX Funciton: DsdX permease Locus tag: b2366 Name: dsdA Funciton: D-serine dehydratase
	b2365	dsdX	DsdX permease
	b2366	dsdA	D-serine dehydratase
Position: -297 Score: 4.4 Sequence: AAGTGCGAGCAAGCTCACAAAA Position: -212 Score: 4.3 Sequence: AATTGAGAACTTACTCAAATTT Locus tag: b3260 Name: dusB Funciton: tRNA-dihydrouridine synthase B Locus tag: b3261 Name: fis Funciton: DNA-binding protein Fis
	b3260	dusB	tRNA-dihydrouridine synthase B
	b3261	fis	DNA-binding protein Fis
Position: -213 Score: 4.7 Sequence: AAGTGTGATGTGAGTCAGATAA Locus tag: b2927 Name: epd Funciton: D-erythrose 4-phosphate dehydrogenase Locus tag: b2926 Name: pgk Funciton: phosphoglycerate kinase
	b2927	epd	D-erythrose 4-phosphate dehydrogenase
	b2926	pgk	phosphoglycerate kinase
Position: -274 Score: 4.2 Sequence: TTTCGTGAGTTAGATCAATAAA Position: -152 Score: 5.1 Sequence: ATTTGTGATGGCTCTCACCTTT Locus tag: b3093 Name: exuT Funciton: Hexuronate transporter
	b3093	exuT	Hexuronate transporter
Position: -131 Score: 3.7 Sequence: AATAGTGACGCGCTTCGCAACC Locus tag: b1805 Name: fadD Funciton: long-chain-fatty-acid--CoA ligase Locus tag: b1804 Name: rnd Funciton: ribonuclease D
	b1805	fadD	long-chain-fatty-acid--CoA ligase
	b1804	rnd	ribonuclease D
Position: -112 Score: 3.9 Sequence: CTTTTTGAATCCCATCACAAAC Locus tag: b3081 Name: fadH Funciton: 2,4-dienoyl-CoA reductase [NADPH] (2,4-dienoyl coenzyme A reductase)
	b3081	fadH	2,4-dienoyl-CoA reductase [NADPH] (2,4-dienoyl coenzyme A reductase)
Position: -21 Score: 3.9 Sequence: CTGTGTTATGGAAATCTCACTA Locus tag: b1187 Name: fadR Funciton: fatty acid metabolism regulator
	b1187	fadR	fatty acid metabolism regulator
Position: -163 Score: 3.9 Sequence: TTTTTTAATCTGCCGCTCATTT Locus tag: b4232 Name: fbp Funciton: fructose-1,6-bisphosphatase
	b4232	fbp	fructose-1,6-bisphosphatase
Position: -213 Score: 3.8 Sequence: TTATTTGATAATCCGCTCACTT Position: -105 Score: 4.7 Sequence: CTGTGTGATATTCATCACCTTA Locus tag: b0518 Name: fdrA Funciton: membrane protein FdrA Locus tag: b4572 Name: ylbE Funciton: hypothetical protein Locus tag: b0520 Name: ylbF Funciton: hypothetical protein Locus tag: b0521 Name: ybcF Funciton: carbamate
	b0518	fdrA	membrane protein FdrA
	b4572	ylbE	hypothetical protein
	b0520	ylbF	hypothetical protein
	b0521	ybcF	carbamate
Position: -215 Score: 4.1 Sequence: ATTGGTGATCCATAAAACAATA Position: -158 Score: 4 Sequence: ATTGGTGAGGAACTTAACAATA Locus tag: b0041 Name: fixA Funciton: electron transfer flavoprotein, beta subunit Locus tag: b0042 Name: PMI2649 Funciton: predicted electron transfer flavoprotein, NAD/FAD-binding domain and ETFP adenine nucleotide-binding domain-like Locus tag: b0043 Name: fixC Funciton: predicted oxidoreductase with FAD/NAD(P)-binding domain Locus tag: b0044 Name: fixX Funciton: ferredoxin-like protein Locus tag: b0045 Name: yaaU Funciton: predicted transporter
	b0041	fixA	electron transfer flavoprotein, beta subunit
	b0042	PMI2649	predicted electron transfer flavoprotein, NAD/FAD-binding domain and ETFP adenine nucleotide-binding domain-like
	b0043	fixC	predicted oxidoreductase with FAD/NAD(P)-binding domain
	b0044	fixX	ferredoxin-like protein
	b0045	yaaU	predicted transporter
Position: -280 Score: 5.1 Sequence: TTGTGTGATCTGCATCACGCAT Locus tag: b1892 Name: flhD Funciton: DNA-binding transcriptional dual regulator with FlhC Locus tag: b1891 Name: flhC Funciton: DNA-binding transcriptional dual regulator with FlhD
	b1892	flhD	DNA-binding transcriptional dual regulator with FlhC
	b1891	flhC	DNA-binding transcriptional dual regulator with FlhD
Position: -156 Score: 3.6 Sequence: TATTTTTATTTGGATAATCAAA Position: -78 Score: 3.8 Sequence: AGATATGATCTATATCAATTTC Locus tag: b0904 Name: focA Funciton: formate transporter Locus tag: b0903 Name: pflB Funciton: formate acetyltransferase
	b0904	focA	formate transporter
	b0903	pflB	formate acetyltransferase
Position: -178 Score: 4.3 Sequence: AATTGTGCAGCACATCAAACTT Locus tag: b2169 Name: fruB Funciton: PTS system, fructose-specific IIA/FPr component Locus tag: b2168 Name: fruK Funciton: 1-phosphofructokinase Locus tag: b2167 Name: fruA Funciton: PTS system, fructose-specific IIBC component
	b2169	fruB	PTS system, fructose-specific IIA/FPr component
	b2168	fruK	1-phosphofructokinase
	b2167	fruA	PTS system, fructose-specific IIBC component
Position: -202 Score: 4 Sequence: ATTTGCGACGCGTCTCACAAGA Position: -147 Score: 4.3 Sequence: AGTTATGAGGCGGATCGCATTT Position: -57 Score: 3.9 Sequence: TATTGTTTCCTCCATCAAAAAT Locus tag: b3949 Name: frwC Funciton: hypothetical protein Locus tag: b3950 Name: frwB Funciton: PTS system fructose-like IIB component 1
	b3949	frwC	hypothetical protein
	b3950	frwB	PTS system fructose-like IIB component 1
Position: -65 Score: 3.7 Sequence: TAGTCTGGTAATAATCACAAAT Locus tag: b0479 Name: fsr Funciton: fosmidomycin resistance protein
	b0479	fsr	fosmidomycin resistance protein
Position: -144 Score: 4.1 Sequence: TTAGTTGAACCAGGTCACAAAA Position: -54 Score: 4 Sequence: TAGTGTGAAAGGAACAACATTA Locus tag: b2800 Name: fucA Funciton: L-fuculose phosphate aldolase Locus tag: b2799 Name: fucO Funciton: L-1,2-propanediol oxidoreductase
	b2800	fucA	L-fuculose phosphate aldolase
	b2799	fucO	L-1,2-propanediol oxidoreductase
Position: -207 Score: 4.9 Sequence: TAAAGTGATGGTAGTCACATAA Position: -167 Score: 4.5 Sequence: AAGTGTGACCGCCGTCATATTA Locus tag: b2801 Name: fucP Funciton: L-fucose permease Locus tag: b2802 Name: fucI Funciton: L-fucose isomerase Locus tag: b2803 Name: fucK Funciton: L-fuculokinase Locus tag: b2804 Name: fucU Funciton: conserved protein of fucose operon Locus tag: b2805 Name: fucR Funciton: DNA-binding transcriptional activator
	b2801	fucP	L-fucose permease
	b2802	fucI	L-fucose isomerase
	b2803	fucK	L-fuculokinase
	b2804	fucU	conserved protein of fucose operon
	b2805	fucR	DNA-binding transcriptional activator
Position: -202 Score: 4.1 Sequence: TACCGTAATCTGGATCACTTTA Position: -152 Score: 4.3 Sequence: ATTTGTGAAATAGATCACCGCT Locus tag: b4140 Name: fxsA Funciton: suppressor of F plamsid exlusion of phage T7
	b4140	fxsA	suppressor of F plamsid exlusion of phage T7
Position: -78 Score: 3.8 Sequence: TAATTTATTCCATGTCACACTT Locus tag: b0759 Name: galE2 Funciton: UDP-galactose-4-epimerase Locus tag: b0758 Name: galT Funciton: galactose-1-phosphate uridylyltransferase Locus tag: b0757 Name: galK Funciton: galactokinase Locus tag: b0756 Name: galM Funciton: aldose 1-epimerase
	b0759	galE2	UDP-galactose-4-epimerase
	b0758	galT	galactose-1-phosphate uridylyltransferase
	b0757	galK	galactokinase
	b0756	galM	aldose 1-epimerase
Position: -156 Score: 3.6 Sequence: TATGATGATATAACTCAATTAT Position: -82 Score: 4.9 Sequence: TGATGTGATTTGCTTCACATCT Locus tag: b2943 Name: galP Funciton: sugar transporter
	b2943	galP	sugar transporter
Position: -226 Score: 5.3 Sequence: AATCGTGATGAAAATCACATTT Locus tag: b1779 Name: gapA Funciton: glyceraldehyde-3-phosphate dehydrogenase Locus tag: b1780 Name: yeaD Funciton: Aldose 1-epimerase
	b1779	gapA	glyceraldehyde-3-phosphate dehydrogenase
	b1780	yeaD	Aldose 1-epimerase
Position: -210 Score: 4.2 Sequence: TATTTTGAGCATATGCACATAA Position: -127 Score: 4.4 Sequence: ATGATTGACATTGATCACATTT Position: -52 Score: 3.7 Sequence: AAATGAGACCAGGTCCTCATTT Locus tag: b3128 Name: garD Funciton: D-galactarate dehydratase
	b3128	garD	D-galactarate dehydratase
Position: -269 Score: 4.4 Sequence: AAATGTGATCAATGTCAATCAT Locus tag: b3127 Name: garP Funciton: d-galactonate transporter Locus tag: b3126 Name: garL Funciton: alpha-dehydro-beta-deoxy-D-glucarate aldolase Locus tag: b3125 Name: garR Funciton: tartronate semialdehyde reductase Locus tag: b3124 Name: garK Funciton: glycerate kinase I
	b3127	garP	d-galactonate transporter
	b3126	garL	alpha-dehydro-beta-deoxy-D-glucarate aldolase
	b3125	garR	tartronate semialdehyde reductase
	b3124	garK	glycerate kinase I
Position: -116 Score: 4.1 Sequence: TTGTGTGACCCAGATCGATATT Locus tag: b2388 Name: glk Funciton: glucokinase
	b2388	glk	glucokinase
Position: -269 Score: 4.2 Sequence: CTTTGTGATCGCTTTCACGGAG Locus tag: b3870 Name: glnA Funciton: glutamine synthetase Locus tag: b3869 Name: glnL Funciton: nitrogen regulation protein NR(II) Locus tag: b3868 Name: glnG Funciton: nitrogen regulation protein NR(I)
	b3870	glnA	glutamine synthetase
	b3869	glnL	nitrogen regulation protein NR(II)
	b3868	glnG	nitrogen regulation protein NR(I)
Position: -165 Score: 4.6 Sequence: AAATGTGAATTGCCGCACACAT Locus tag: b2241 Name: glpA Funciton: sn-glycerol-3-phosphate dehydrogenase subunit A Locus tag: b2242 Name: glpB Funciton: Glycerol-3-phosphate dehydrogenase subunit B Locus tag: b2243 Name: glpC Funciton: anaerobic glycerol-3-phosphate dehydrogenase subunit C
	b2241	glpA	sn-glycerol-3-phosphate dehydrogenase subunit A
	b2242	glpB	Glycerol-3-phosphate dehydrogenase subunit B
	b2243	glpC	anaerobic glycerol-3-phosphate dehydrogenase subunit C
Position: -116 Score: 4.4 Sequence: TAATGTTATACATATCACTCTA Locus tag: b3426 Name: glpD Funciton: glycerol-3-phosphate dehydrogenase
	b3426	glpD	glycerol-3-phosphate dehydrogenase
Position: -95 Score: 4.7 Sequence: TAGAGTGATATGTATAACATTA Locus tag: b3425 Name: glpE Funciton: thiosulfate sulfurtransferase Locus tag: b3424 Name: glpG Funciton: predicted intramembrane serine protease Locus tag: b3423 Name: glpR2 Funciton: DNA-binding transcriptional repressor
	b3425	glpE	thiosulfate sulfurtransferase
	b3424	glpG	predicted intramembrane serine protease
	b3423	glpR2	DNA-binding transcriptional repressor
Position: -142 Score: 4 Sequence: TTTTATGACGAGGCACACACAT Locus tag: b3927 Name: glpF Funciton: facilitator for glycerol uptake Locus tag: b3926 Name: glpK Funciton: glycerol kinase Locus tag: b3925 Name: glpX Funciton: fructose 1,6-bisphosphatase II
	b3927	glpF	facilitator for glycerol uptake
	b3926	glpK	glycerol kinase
	b3925	glpX	fructose 1,6-bisphosphatase II
Position: -219 Score: 3.7 Sequence: TTGTTTGATTTCGCGCATATTC Position: -179 Score: 3.6 Sequence: AAACGTGATTTCATGCGTCATT Position: -129 Score: 4.6 Sequence: ATGTGTGCGGCAATTCACATTT Locus tag: b2240 Name: glpT Funciton: glycerol-3-phosphate transporter Locus tag: b2239 Name: glpQ Funciton: glycerophosphoryl diester phosphodiesterase
	b2240	glpT	glycerol-3-phosphate transporter
	b2239	glpQ	glycerophosphoryl diester phosphodiesterase
Position: -229 Score: 3.8 Sequence: GAATGTGATGAAGTGAAAAATT Locus tag: b2551 Name: glyA Funciton: serine hydroxymethyltransferase
	b2551	glyA	serine hydroxymethyltransferase
Position: -132 Score: 4.8 Sequence: AAATTTGAAGTAGCTCACACTT Locus tag: b3437 Name: gntK Funciton: gluconate kinase 1 Locus tag: b4476 Name: gntU Funciton: Low-affinity gluconate transporter (Gluconate permease)
	b3437	gntK	gluconate kinase 1
	b4476	gntU	Low-affinity gluconate transporter (Gluconate permease)
Position: -199 Score: 4.2 Sequence: AATTTTGCGCTAAAGCACATTT Locus tag: b3212 Name: gltB Funciton: glutamate synthase, large subunit Locus tag: b3213 Name: gltD Funciton: glutamate synthase, small subunit
	b3212	gltB	glutamate synthase, large subunit
	b3213	gltD	glutamate synthase, small subunit
Position: -236 Score: 4.2 Sequence: AAACGTGATCAATTTAACACCT Locus tag: b3805 Name: hemC Funciton: porphobilinogen deaminase Locus tag: b3804 Name: hemD Funciton: uroporphyrinogen-III synthase Locus tag: b3803 Name: hemX Funciton: uroporphyrinogen III methylase Locus tag: b3802 Name: hemY Funciton: HemY protein
	b3805	hemC	porphobilinogen deaminase
	b3804	hemD	uroporphyrinogen-III synthase
	b3803	hemX	uroporphyrinogen III methylase
	b3802	hemY	HemY protein
Position: -229 Score: 4.1 Sequence: AAATGTGACATGAATCAGGAAG Locus tag: b1237 Name: hns Funciton: global DNA-binding transcriptional dual regulator H-NS
	b1237	hns	global DNA-binding transcriptional dual regulator H-NS
Position: -147 Score: 5.3 Sequence: ATGTGTGATCGTCATCACAATT Locus tag: b0125 Name: hpt Funciton: hypoxanthine phosphoribosyltransferase
	b0125	hpt	hypoxanthine phosphoribosyltransferase
Position: -81 Score: 5.1 Sequence: TGACGTGATCTTCATCACAAAT Locus tag: b4267 Name: idnD Funciton: L-idonate 5-dehydrogenase Locus tag: b4266 Name: idnO Funciton: 5-keto-D-gluconate-5-reductase Locus tag: b4265 Name: idnT Funciton: L-idonate and D-gluconate transporter Locus tag: b4264 Name: idnR Funciton: DNA-binding transcriptional repressor, 5-gluconate-binding
	b4267	idnD	L-idonate 5-dehydrogenase
	b4266	idnO	5-keto-D-gluconate-5-reductase
	b4265	idnT	L-idonate and D-gluconate transporter
	b4264	idnR	DNA-binding transcriptional repressor, 5-gluconate-binding
Position: -110 Score: 4.7 Sequence: TAATGTGAGTTAGCTCACTCAT Locus tag: b0344 Name: lacZ Funciton: beta-D-galactosidase Locus tag: b0343 Name: lacY Funciton: galactoside permease Locus tag: b0342 Name: lacA Funciton: galactoside O-acetyltransferase
	b0344	lacZ	beta-D-galactosidase
	b0343	lacY	galactoside permease
	b0342	lacA	galactoside O-acetyltransferase
Position: -56 Score: 3.6 Sequence: TTGTGTAATACTTGTAACGCTA Locus tag: b1677 Name: lpp Funciton: major outer membrane lipoprotein
	b1677	lpp	major outer membrane lipoprotein
Position: -189 Score: 4.2 Sequence: TTCTGTGATCTACTTCAGGCAT Locus tag: b2289 Name: lrhA Funciton: transcriptional regulator, LysR family
	b2289	lrhA	transcriptional regulator, LysR family
Position: -183 Score: 4.3 Sequence: ATCTGTGATGGCAACCACAGTT Locus tag: b1513 Name: lsrA Funciton: ABC transporter related Locus tag: b1514 Name: lsrC Funciton: putative ABC transport system permease protein Locus tag: b1515 Name: lsrD Funciton: putative ABC transport system permease protein Locus tag: b1516 Name: lsrB Funciton: putative ABC superfamily (peri_perm), sugar transport protein Locus tag: b1517 Name: lsrF Funciton: hypothetical protein Locus tag: b1518 Name: lsrG Funciton: autoinducer-2 (AI-2) modifying protein LsrG
	b1513	lsrA	ABC transporter related
	b1514	lsrC	putative ABC transport system permease protein
	b1515	lsrD	putative ABC transport system permease protein
	b1516	lsrB	putative ABC superfamily (peri_perm), sugar transport protein
	b1517	lsrF	hypothetical protein
	b1518	lsrG	autoinducer-2 (AI-2) modifying protein LsrG
Position: -97 Score: 4.8 Sequence: CTATGTGATCTTTATCACACAG Locus tag: b0459 Name: maa Funciton: maltose O-acetyltransferase
	b0459	maa	maltose O-acetyltransferase
Position: -257 Score: 3.9 Sequence: ATGAGTGCGTTAATTCACACTT Locus tag: b2463 Name: maeB Funciton: malic enzyme
	b2463	maeB	malic enzyme
Position: -195 Score: 4.4 Sequence: TTTCGTGATGTTGCTTGCAAAA Position: -161 Score: 4 Sequence: TTATGTGCGCATCTCCACATTA Position: -132 Score: 4.3 Sequence: TTCTGTAACAGAGATCACACAA Locus tag: b4034 Name: malE Funciton: maltose ABC transporter periplasmic protein Locus tag: b4033 Name: malF Funciton: ABC superfamily (membrane), maltose transport protein Locus tag: b4032 Name: malG Funciton: ABC superfamily (membrane), maltose transport protein
	b4034	malE	maltose ABC transporter periplasmic protein
	b4033	malF	ABC superfamily (membrane), maltose transport protein
	b4032	malG	ABC superfamily (membrane), maltose transport protein
Position: -254 Score: 4.4 Sequence: TTGTGTGATCTCTGTTACAGAA Position: -225 Score: 3.9 Sequence: TAATGTGGAGATGCGCACATAA Position: -191 Score: 3.7 Sequence: TTTTGCAAGCAACATCACGAAA Locus tag: b4035 Name: malK Funciton: maltose/maltodextrin transporter ATP-binding protein Locus tag: b4036 Name: lamB Funciton: maltoporin Locus tag: b4037 Name: malM Funciton: maltose regulon periplasmic protein
	b4035	malK	maltose/maltodextrin transporter ATP-binding protein
	b4036	lamB	maltoporin
	b4037	malM	maltose regulon periplasmic protein
Position: -141 Score: 4.5 Sequence: TTAAGTGGTTGAGATCACATTT Locus tag: b3417 Name: malP Funciton: maltodextrin phosphorylase Locus tag: b3416 Name: malQ Funciton: 4-alpha-glucanotransferase
	b3417	malP	maltodextrin phosphorylase
	b3416	malQ	4-alpha-glucanotransferase
Position: -269 Score: 4.2 Sequence: ATTTGAGAGTTGAATCTCAAAT Position: -152 Score: 4.1 Sequence: AAATGTGGGGGTTATCGCAAAA Position: -118 Score: 3.6 Sequence: TTGCGCGAGATCGCTCACCCTT Locus tag: b3571 Name: malS Funciton: periplasmic alpha-amylase precursor
	b3571	malS	periplasmic alpha-amylase precursor
Position: -142 Score: 4.3 Sequence: AATTGTGACACAGTGCAAATTC Locus tag: b3418 Name: malT Funciton: transcriptional regulator MalT
	b3418	malT	transcriptional regulator MalT
Position: -154 Score: 4.1 Sequence: TTATGTGACAGATAAAACGTTT Position: -94 Score: 4.4 Sequence: TAATGTGATTTATGCCTCACTA Locus tag: b1621 Name: malX Funciton: PTS family enzyme IIC/enzyme IIB Locus tag: b1622 Name: malY Funciton: aminotransferase class I and II
	b1621	malX	PTS family enzyme IIC/enzyme IIB
	b1622	malY	aminotransferase class I and II
Position: -60 Score: 3.8 Sequence: TATTGTGTTGATTATCACTCAG Locus tag: b1818 Name: manY Funciton: PTS system, mannose/fructose/sorbose family, IIC subunit Locus tag: b1819 Name: manZ Funciton: PTS enzyme IID, mannose-specific Locus tag: b1820 Name: yobD Funciton: hypothetical protein
	b1818	manY	PTS system, mannose/fructose/sorbose family, IIC subunit
	b1819	manZ	PTS enzyme IID, mannose-specific
	b1820	yobD	hypothetical protein
Position: -270 Score: 4.5 Sequence: ATCTGTGAGTGATTTCACAGTA Locus tag: b2150 Name: mglB Funciton: Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3) Locus tag: b2149 Name: mglA Funciton: Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17) Locus tag: b2148 Name: mglC Funciton: Galactose/methyl galactoside ABC transport system, permease protein MglC (TC 3.A.1.2.3)
	b2150	mglB	Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3)
	b2149	mglA	Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17)
	b2148	mglC	Galactose/methyl galactoside ABC transport system, permease protein MglC (TC 3.A.1.2.3)
Position: -164 Score: 3.9 Sequence: TTTTTTTACCCCGATCACGGAT Locus tag: b2813 Name: mltA Funciton: membrane-bound lytic murein transglycosylase A
	b2813	mltA	membrane-bound lytic murein transglycosylase A
Position: -184 Score: 4.6 Sequence: AAGTGTTATTTTGATCGCAAAA Locus tag: b2701 Name: mltB Funciton: membrane-bound lytic murein transglycosylase B
	b2701	mltB	membrane-bound lytic murein transglycosylase B
Position: -212 Score: 4.3 Sequence: AAATTTAATTCGTATCGCAAAT Position: -178 Score: 4.6 Sequence: TTTTGTGAGTTTTGTCACCAAA Locus tag: b0678 Name: nagB Funciton: Glucosamine-6-phosphate deaminase (EC 3.5.99.6) Locus tag: b0677 Name: nagA Funciton: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25) Locus tag: b0676 Name: nagC Funciton: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family Locus tag: b0675 Name: nagD Funciton: Phosphatase NagD predicted to act in N-acetylglucosamine utilization subsystem
	b0678	nagB	Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
	b0677	nagA	N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
	b0676	nagC	N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
	b0675	nagD	Phosphatase NagD predicted to act in N-acetylglucosamine utilization subsystem
Position: -176 Score: 4.4 Sequence: TTTGGTGACAAAACTCACAAAA Position: -142 Score: 4.2 Sequence: ATTTGCGATACGAATTAAATTT Locus tag: b0679 Name: nagE Funciton: PTS system, N-acetylglucosamine-specific IIA component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)
	b0679	nagE	PTS system, N-acetylglucosamine-specific IIA component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)
Position: -115 Score: 4.6 Sequence: TTTAGTGAAGCAGATCGCATTA Locus tag: b3225 Name: nanA Funciton: N-acetylneuraminate lyase (EC 4.1.3.3) Locus tag: b3224 Name: nanT Funciton: Sialic acid transporter (permease) NanT Locus tag: b3223 Name: nanE Funciton: N-acetylmannosamine-6-phosphate 2-epimerase (EC 5.1.3.9) Locus tag: b3222 Name: yhcI Funciton: N-acetylmannosamine kinase (EC 2.7.1.60) Locus tag: b3221 Name: yhcH Funciton: Putative sugar isomerase involved in processing of exogenous sialic acid
	b3225	nanA	N-acetylneuraminate lyase (EC 4.1.3.3)
	b3224	nanT	Sialic acid transporter (permease) NanT
	b3223	nanE	N-acetylmannosamine-6-phosphate 2-epimerase (EC 5.1.3.9)
	b3222	yhcI	N-acetylmannosamine kinase (EC 2.7.1.60)
	b3221	yhcH	Putative sugar isomerase involved in processing of exogenous sialic acid
Position: -154 Score: 3.9 Sequence: AAACTTGATTAACATCAATTTT Locus tag: b1109 Name: ndh Funciton: NADH dehydrogenase (EC 1.6.99.3)
	b1109	ndh	NADH dehydrogenase (EC 1.6.99.3)
Position: -53 Score: 3.7 Sequence: AAGCGTGTCCGATATCGCACAA Locus tag: b3397 Name: nudE Funciton: ADP compounds hydrolase NudE (EC 3.6.1.-)
	b3397	nudE	ADP compounds hydrolase NudE (EC 3.6.1.-)
Position: -183 Score: 4 Sequence: TAATGTTAGCACATTTACATAA Position: -84 Score: 3.8 Sequence: TAGTGTGTGTCAGATCTCGTTT Position: -31 Score: 4.1 Sequence: AAATTTAACCTGCCTCATATTT Locus tag: b2393 Name: nupC Funciton: Nucleoside permease NupC
	b2393	nupC	Nucleoside permease NupC
Position: -166 Score: 5.2 Sequence: AAATGTTATCCACATCACAATT Position: -116 Score: 3.8 Sequence: TTATTTGCCACAGGTAACAAAA Locus tag: b2964 Name: nupG Funciton: Nucleoside permease NupG
	b2964	nupG	Nucleoside permease NupG
Position: -188 Score: 4 Sequence: ATGCCTGACGGAGTTCACACTT Locus tag: b0957 Name: ompA Funciton: outer membrane protein A
	b0957	ompA	outer membrane protein A
Position: -242 Score: 4.4 Sequence: AAATATGACGGTGTTCACAAAG Locus tag: b0929 Name: ompF Funciton: Outer membrane protein F precursor
	b0929	ompF	Outer membrane protein F precursor
Position: -183 Score: 3.9 Sequence: TAACGTGATCATATCAACAGAA Locus tag: b3405 Name: ompR Funciton: Two-component system response regulator OmpR Locus tag: b3404 Name: envZ Funciton: osmolarity sensor protein
	b3405	ompR	Two-component system response regulator OmpR
	b3404	envZ	osmolarity sensor protein
Position: -166 Score: 4.9 Sequence: AAAATTGATTTAAATCACATTA Position: -82 Score: 3.8 Sequence: TAATGTGATCTATGTAGGATCA Locus tag: b1256 Name: ompW Funciton: outer membrane protein W
	b1256	ompW	outer membrane protein W
Position: -266 Score: 4.4 Sequence: AATTGTGATCTATATTTAACAA Locus tag: b4376 Name: osmY Funciton: Osmotically inducible protein OsmY
	b4376	osmY	Osmotically inducible protein OsmY
Position: -240 Score: 4.2 Sequence: GAATGCGATTCCACTCACAATA Position: -137 Score: 4 Sequence: TTTCGTGACAGGAATCACGGAG Locus tag: b3403 Name: pck Funciton: Phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49)
	b3403	pck	Phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49)
Position: -73 Score: 3.6 Sequence: AAAAGTGACCTGACGCAATATT Locus tag: b1127 Name: pepT Funciton: peptidase T
	b1127	pepT	peptidase T
Position: -204 Score: 4.2 Sequence: TTTTGTGATCTGTTTAAATGTT Position: -151 Score: 4.2 Sequence: AGAGGTGATTTTGATCACGGAA Locus tag: b3363 Name: ppiA Funciton: Peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)
	b3363	ppiA	Peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)
Position: -154 Score: 4.4 Sequence: AAACGTGATAGCCGTCAAACAA Locus tag: b1101 Name: ptsG Funciton: PTS system, glucose-specific IIB component (EC 2.7.1.69) / PTS system, glucose-specific IIC component (EC 2.7.1.69)
	b1101	ptsG	PTS system, glucose-specific IIB component (EC 2.7.1.69) / PTS system, glucose-specific IIC component (EC 2.7.1.69)
Position: -209 Score: 3.9 Sequence: TTTTATGATTTGGTTCAATTCT Locus tag: b2415 Name: ptsH Funciton: PTS system phosphocarrier protein Locus tag: b2416 Name: ptsI Funciton: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) Locus tag: b2417 Name: crr Funciton: PTS system, glucose-specific IIA component (EC 2.7.1.69)
	b2415	ptsH	PTS system phosphocarrier protein
	b2416	ptsI	Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
	b2417	crr	PTS system, glucose-specific IIA component (EC 2.7.1.69)
Position: -207 Score: 3.6 Sequence: AAATGTGAGAGAGTGCAACCTG Locus tag: b1015 Name: putP Funciton: Proline/sodium symporter PutP (TC 2.A.21.2.1)
	b1015	putP	Proline/sodium symporter PutP (TC 2.A.21.2.1)
Position: -201 Score: 4 Sequence: TGTTTTAAGCTCACTCACATAT Locus tag: b1951 Name: rcsA Funciton: Colanic acid capsular biosynthesis activation accesory protein RcsA, co-regulator with RcsB
	b1951	rcsA	Colanic acid capsular biosynthesis activation accesory protein RcsA, co-regulator with RcsB
Position: -162 Score: 3.8 Sequence: AAATGCGGTGAGCATCACATCA Position: -127 Score: 4.4 Sequence: AATTGTGAACATCATCACGTTC Locus tag: b3904 Name: rhaB Funciton: rhamnulokinase Locus tag: b3903 Name: rhaA Funciton: L-rhamnose isomerase Locus tag: b3902 Name: rhaD Funciton: rhamnulose-1-phosphate aldolase
	b3904	rhaB	rhamnulokinase
	b3903	rhaA	L-rhamnose isomerase
	b3902	rhaD	rhamnulose-1-phosphate aldolase
Position: -182 Score: 4.5 Sequence: GAACGTGATGATGTTCACAATT Position: -147 Score: 4.5 Sequence: TGATGTGATGCTCACCGCATTT Locus tag: b3905 Name: rhaS Funciton: L-rhamnose operon regulatory protein RhaS Locus tag: b3906 Name: rhaR Funciton: L-rhamnose operon transcriptional activator RhaR
	b3905	rhaS	L-rhamnose operon regulatory protein RhaS
	b3906	rhaR	L-rhamnose operon transcriptional activator RhaR
Position: -145 Score: 4.1 Sequence: AGATGTGAAGCAAATCACCCAC Locus tag: b3907 Name: rhaT Funciton: L-rhamnose-proton symport
	b3907	rhaT	L-rhamnose-proton symport
Position: -140 Score: 3.8 Sequence: GAATGTGACGCAAATCACTTCA Locus tag: b0610 Name: rnk Funciton: Regulator of nucleoside diphosphate kinase
	b0610	rnk	Regulator of nucleoside diphosphate kinase
Position: -179 Score: 4.2 Sequence: ATTTGAGATCAAGATCACTGAT Locus tag: b2796 Name: sdaC Funciton: Serine transporter Locus tag: b2797 Name: sdaB Funciton: L-serine dehydratase 1
	b2796	sdaC	Serine transporter
	b2797	sdaB	L-serine dehydratase 1
Position: -210 Score: 4.1 Sequence: TTTGGTGACATGTGTCACGCTT Locus tag: b2913 Name: serA Funciton: D-3-phosphoglycerate dehydrogenase
	b2913	serA	D-3-phosphoglycerate dehydrogenase
Position: -211 Score: 4.6 Sequence: AAGTTTGATGTGCTGCACAATT Locus tag: b2170 Name: setB Funciton: Sugar efflux transporter B
	b2170	setB	Sugar efflux transporter B
Position: -161 Score: 3.8 Sequence: GTGGGTGATTTGCTTCACATCT Locus tag: b3908 Name: sodA Funciton: Manganese superoxide dismutase (EC 1.15.1.1)
	b3908	sodA	Manganese superoxide dismutase (EC 1.15.1.1)
Position: -130 Score: 4.1 Sequence: TTTTGTGCGTTAGTCCACAGAT Locus tag: b2175 Name: spr Funciton: predicted peptidase, outer membrane lipoprotein
	b2175	spr	predicted peptidase, outer membrane lipoprotein
Position: -93 Score: 4.4 Sequence: TTTTGCGATCAAAATAACACTT Locus tag: b2702 Name: srlA Funciton: PTS system, glucitol/sorbitol-specific IIC component (EC 2.7.1.69) Locus tag: b2703 Name: srlE Funciton: PTS system, glucitol/sorbitol-specific IIB component and second of two IIC components (EC 2.7.1.69) Locus tag: b2704 Name: srlB Funciton: PTS system, glucitol/sorbitol-specific IIA component (EC 2.7.1.69) Locus tag: b2705 Name: srlD Funciton: Sorbitol-6-phosphate 2-dehydrogenase (EC 1.1.1.140) Locus tag: b2706 Name: srlM Funciton: DNA-binding transcriptional activator of glucitol operon Locus tag: b2707 Name: srlR Funciton: Transcriptional repressor for glucitol operon, DeoR family Locus tag: b2708 Name: srlQ Funciton: Glucitol operon SrlQ protein
	b2702	srlA	PTS system, glucitol/sorbitol-specific IIC component (EC 2.7.1.69)
	b2703	srlE	PTS system, glucitol/sorbitol-specific IIB component and second of two IIC components (EC 2.7.1.69)
	b2704	srlB	PTS system, glucitol/sorbitol-specific IIA component (EC 2.7.1.69)
	b2705	srlD	Sorbitol-6-phosphate 2-dehydrogenase (EC 1.1.1.140)
	b2706	srlM	DNA-binding transcriptional activator of glucitol operon
	b2707	srlR	Transcriptional repressor for glucitol operon, DeoR family
	b2708	srlQ	Glucitol operon SrlQ protein
Position: -83 Score: 4 Sequence: TTTTTTGATGCGTTTAGCGAAA Position: -53 Score: 3.9 Sequence: AAGTGTGAATTAACGCACTCAT Locus tag: b2464 Name: talA Funciton: Transaldolase (EC 2.2.1.2) Locus tag: b2465 Name: tktB Funciton: Transketolase (EC 2.2.1.1)
	b2464	talA	Transaldolase (EC 2.2.1.2)
	b2465	tktB	Transketolase (EC 2.2.1.1)
Position: -225 Score: 4 Sequence: TGATGTTATCGCCATAAAATAT Position: -82 Score: 4.7 Sequence: ATTTGTGAGTGGTCGCACATAT Locus tag: b3118 Name: tdcA Funciton: Threonine catabolic operon transcriptional activator TdcA Locus tag: b3117 Name: tdcB Funciton: Threonine dehydratase, catabolic (EC 4.3.1.19) Locus tag: b3116 Name: tdcC Funciton: L-threonine/L-serine permease Locus tag: b3115 Name: tdcD Funciton: Propionate kinase (EC 2.7.2.15) / Acetate kinase (EC 2.7.2.1) Locus tag: b3114 Name: tdcE Funciton: 2-ketobutyrate formate-lyase (EC 2.3.1.-) / Pyruvate formate-lyase (EC 2.3.1.54) Locus tag: b3113 Name: yhaR Funciton: Hypothetical protein TdcF in cluster with anaerobic degradation of L-threonine to propionate Locus tag: b4471 Name: tdcG Funciton: Predicted L-serine dehydratase (EC 4.3.1.17) TdcG
	b3118	tdcA	Threonine catabolic operon transcriptional activator TdcA
	b3117	tdcB	Threonine dehydratase, catabolic (EC 4.3.1.19)
	b3116	tdcC	L-threonine/L-serine permease
	b3115	tdcD	Propionate kinase (EC 2.7.2.15) / Acetate kinase (EC 2.7.2.1)
	b3114	tdcE	2-ketobutyrate formate-lyase (EC 2.3.1.-) / Pyruvate formate-lyase (EC 2.3.1.54)
	b3113	yhaR	Hypothetical protein TdcF in cluster with anaerobic degradation of L-threonine to propionate
	b4471	tdcG	Predicted L-serine dehydratase (EC 4.3.1.17) TdcG
Position: -138 Score: 3.9 Sequence: AAGTGTGGCACACATCACGCAT Locus tag: b0452 Name: tesB Funciton: Acyl-CoA thioesterase II (EC 3.1.2.-)
	b0452	tesB	Acyl-CoA thioesterase II (EC 3.1.2.-)
Position: -83 Score: 3.8 Sequence: TTTATTGACTTAGGTCACTAAA Locus tag: b0001 Name: thrL Funciton: Thr operon leader peptide Locus tag: b0002 Name: thrA Funciton: Aspartokinase (EC 2.7.2.4) / Homoserine dehydrogenase (EC 1.1.1.3) Locus tag: b0003 Name: thrB Funciton: Homoserine kinase (EC 2.7.1.39) Locus tag: b0004 Name: thrC Funciton: Threonine synthase (EC 4.2.3.1)
	b0001	thrL	Thr operon leader peptide
	b0002	thrA	Aspartokinase (EC 2.7.2.4) / Homoserine dehydrogenase (EC 1.1.1.3)
	b0003	thrB	Homoserine kinase (EC 2.7.1.39)
	b0004	thrC	Threonine synthase (EC 4.2.3.1)
Position: -101 Score: 3.8 Sequence: AATTGTGATCTTCGCTGCGTTT Locus tag: b4240 Name: treB Funciton: PTS system, trehalose-specific IIB component (EC 2.7.1.69) / PTS system, trehalose-specific IIC component (EC 2.7.1.69) Locus tag: b4239 Name: treC Funciton: Trehalose-6-phosphate hydrolase (EC 3.2.1.93)
	b4240	treB	PTS system, trehalose-specific IIB component (EC 2.7.1.69) / PTS system, trehalose-specific IIC component (EC 2.7.1.69)
	b4239	treC	Trehalose-6-phosphate hydrolase (EC 3.2.1.93)
Position: -250 Score: 3.7 Sequence: TTTTGTTACTCTGCTTACATCA Position: -129 Score: 3.9 Sequence: AACTGTGAAACGAAACATATTT Locus tag: b0411 Name: tsx Funciton: Nucleoside-specific channel-forming protein Tsx precursor
	b0411	tsx	Nucleoside-specific channel-forming protein Tsx precursor
Position: -144 Score: 5.2 Sequence: TTATGTGATTTGCATCACTTTT Position: -92 Score: 4.2 Sequence: CATGGTGATGAGTATCACGAAA Locus tag: b3831 Name: udp Funciton: Uridine phosphorylase (EC 2.4.2.3)
	b3831	udp	Uridine phosphorylase (EC 2.4.2.3)
Position: -174 Score: 4 Sequence: ATTTGTGATTATTACCAGACTA Locus tag: b0480 Name: ushA Funciton: UDP-sugar hydrolase (EC 3.6.1.45); 5'-nucleotidase (EC 3.1.3.5)
	b0480	ushA	UDP-sugar hydrolase (EC 3.6.1.45); 5'-nucleotidase (EC 3.1.3.5)
Position: -232 Score: 4.5 Sequence: AAAGGTGAGAGCCATCACAAAT Position: -110 Score: 4.4 Sequence: TTTATTGATCTAACTCACGAAA Locus tag: b3092 Name: uxaC Funciton: Uronate isomerase (EC 5.3.1.12) Locus tag: b3091 Name: uxaA Funciton: Altronate hydrolase (EC 4.2.1.7)
	b3092	uxaC	Uronate isomerase (EC 5.3.1.12)
	b3091	uxaA	Altronate hydrolase (EC 4.2.1.7)
Position: -271 Score: 3.8 Sequence: TGTTGCGATGAATGTCACATCC Position: -186 Score: 4.5 Sequence: TCTTGTGATGTGGTTAACCAAT Locus tag: b4322 Name: uxuA Funciton: Mannonate dehydratase (EC 4.2.1.8) Locus tag: b4323 Name: uxuB Funciton: D-mannonate oxidoreductase (EC 1.1.1.57)
	b4322	uxuA	Mannonate dehydratase (EC 4.2.1.8)
	b4323	uxuB	D-mannonate oxidoreductase (EC 1.1.1.57)
Position: -224 Score: 3.9 Sequence: ATTTATGACCGAGATCTTACTT Position: -134 Score: 4.2 Sequence: TTTTGCGAGCGAGCGCACACTT Locus tag: b3565 Name: xylA Funciton: Xylose isomerase (EC 5.3.1.5) Locus tag: b3564 Name: xylB Funciton: Xylulose kinase (EC 2.7.1.17)
	b3565	xylA	Xylose isomerase (EC 5.3.1.5)
	b3564	xylB	Xylulose kinase (EC 2.7.1.17)
Position: -253 Score: 4.2 Sequence: AAGTGTGCGCTCGCTCGCAAAA Position: -163 Score: 3.7 Sequence: AAGTAAGATCTCGGTCATAAAT Locus tag: b3566 Name: xylF Funciton: Xylose ABC transporter, periplasmic xylose-binding protein XylF Locus tag: b3567 Name: xylG Funciton: D-xylose transport ATP-binding protein XylG Locus tag: b3568 Name: xylH Funciton: Xylose ABC transporter, permease protein XylH Locus tag: b3569 Name: xylR Funciton: Xylose activator XylR (AraC family)
	b3566	xylF	Xylose ABC transporter, periplasmic xylose-binding protein XylF
	b3567	xylG	D-xylose transport ATP-binding protein XylG
	b3568	xylH	Xylose ABC transporter, permease protein XylH
	b3569	xylR	Xylose activator XylR (AraC family)
Position: -70 Score: 4.1 Sequence: AGTTTTGACGGCTATCACCCTT Locus tag: b0129 Name: yadI Funciton: predicted PTS Enzyme IIA
	b0129	yadI	predicted PTS Enzyme IIA
Position: -109 Score: 3.9 Sequence: ATCTGTGAACTTCACCACAACT Locus tag: b0162 Name: cdaR Funciton: carbohydrate diacid regulator
	b0162	cdaR	carbohydrate diacid regulator
Position: -41 Score: 3.9 Sequence: CTTTGTGATCTCTCTCGCACCC Locus tag: b0328 Name: yahN Funciton: putative transport protein
	b0328	yahN	putative transport protein
Position: -101 Score: 4.3 Sequence: ATGCGTGATGTGTGCCACACTT Locus tag: b0453 Name: ybaY Funciton: Glycoprotein-polysaccharide metabolism
	b0453	ybaY	Glycoprotein-polysaccharide metabolism
Position: -94 Score: 3.6 Sequence: AAGTGTAATTTCCGTCCCCATA Locus tag: b0631 Name: ybeD Funciton: hypothetical protein Locus tag: b0630 Name: lipB Funciton: Octanoate-[acyl-carrier-protein]-protein-N-octanoyltransferase
	b0631	ybeD	hypothetical protein
	b0630	lipB	Octanoate-[acyl-carrier-protein]-protein-N-octanoyltransferase
Position: -56 Score: 4.2 Sequence: TTTTGTGACGCCGACTACACTA Locus tag: b0790 Name: ybhP Funciton: hypothetical protein Locus tag: b0789 Name: ybhO Funciton: Cardiolipin synthetase (EC 2.7.8.-) Locus tag: b0788 Name: ybhN Funciton: hypothetical protein
	b0790	ybhP	hypothetical protein
	b0789	ybhO	Cardiolipin synthetase (EC 2.7.8.-)
	b0788	ybhN	hypothetical protein
Position: -98 Score: 3.9 Sequence: TAGTGTAGTCGGCGTCACAAAA Locus tag: b0791 Name: ybhQ Funciton: putative inner membrane protein
	b0791	ybhQ	putative inner membrane protein
Position: -123 Score: 4.5 Sequence: TTTTGTGACGCAGCGCATAAAT Locus tag: b0796 Name: ybiH Funciton: putative transcriptional regulator Locus tag: b0795 Name: ybhG Funciton: hypothetical protein Locus tag: b0794 Name: ybhF Funciton: ABC transporter-related protein Locus tag: b0793 Name: ybhS Funciton: ABC-2 type transporter Locus tag: b0792 Name: ybhR Funciton: ABC-2 type transporter
	b0796	ybiH	putative transcriptional regulator
	b0795	ybhG	hypothetical protein
	b0794	ybhF	ABC transporter-related protein
	b0793	ybhS	ABC-2 type transporter
	b0792	ybhR	ABC-2 type transporter
Position: -116 Score: 4.7 Sequence: AAATGTGATTTCGTACACATCT Locus tag: b0819 Name: ybiS Funciton: hypothetical protein
	b0819	ybiS	hypothetical protein
Position: -124 Score: 4.4 Sequence: AGATGTGTACGAAATCACATTT Locus tag: b0820 Name: ybiT Funciton: ABC transporter ATP-binding protein
	b0820	ybiT	ABC transporter ATP-binding protein
Position: -29 Score: 4.2 Sequence: AAATTTGAACTTCCTCACGGTT Locus tag: b0898 Name: ycaD Funciton: Hypothetical MFS-type transporter protein ycaD
	b0898	ycaD	Hypothetical MFS-type transporter protein ycaD
Position: -52 Score: 4 Sequence: AAATGTGTGCTCGATCTCATTC Position: -50 Score: 3.7 Sequence: ATGTGTGCTCGATCTCATTCAT Locus tag: b1036 Name: ycdZ Funciton: hypothetical protein
	b1036	ycdZ	hypothetical protein
Position: -175 Score: 5.3 Sequence: AGATGTGATCTGGATCACATAC Locus tag: b1111 Name: ycfQ Funciton: hypothetical protein
	b1111	ycfQ	hypothetical protein
Position: -114 Score: 3.7 Sequence: ATTAATGATTGTTATAAAAAAT Position: -87 Score: 4.8 Sequence: GTATGTGATCCAGATCACATCT Locus tag: b1112 Name: ycfR Funciton: hypothetical protein
	b1112	ycfR	hypothetical protein
Position: -235 Score: 4.4 Sequence: TATGGTGAGCTGGCTCACATCT Locus tag: b1188 Name: ycgB Funciton: hypothetical protein
	b1188	ycgB	hypothetical protein
Position: -257 Score: 5.1 Sequence: TTACGTGATCCAAATCAAATTT Locus tag: b1242 Name: ychE Funciton: putative channel protein
	b1242	ychE	putative channel protein
Position: -105 Score: 4.5 Sequence: AATTGTGATCACGCCCGCACAT Locus tag: b1205 Name: ychH Funciton: membrane protein
	b1205	ychH	membrane protein
Position: -96 Score: 3.9 Sequence: AAACACGATCCCGCTCGCATTT Locus tag: b1426 Name: ydcH Funciton: hypothetical protein
	b1426	ydcH	hypothetical protein
Position: -71 Score: 3.7 Sequence: TTTTGCAATCAAGTTATCATAA Locus tag: b1422 Name: ydcI Funciton: putative transcriptional regulators, LysR family
	b1422	ydcI	putative transcriptional regulators, LysR family
Position: -216 Score: 4 Sequence: GGATGTGAAATTAATCACAGTA Locus tag: b1431 Name: ydcL Funciton: hypothetical protein
	b1431	ydcL	hypothetical protein
Position: -94 Score: 4.9 Sequence: AAACGCGATCCAGATCACAAAT Locus tag: b1528 Name: sotB Funciton: Probable sugar efflux transporter
	b1528	sotB	Probable sugar efflux transporter
Position: -93 Score: 4 Sequence: TTATCTGATTTTACTCCCACTT Locus tag: b1598 Name: ydgD Funciton: hypothetical protein
	b1598	ydgD	hypothetical protein
Position: -132 Score: 3.6 Sequence: ATATTTGAAATGCAACAAATAG Locus tag: b1654 Name: ydhD Funciton: hypothetical protein
	b1654	ydhD	hypothetical protein
Position: -73 Score: 4.3 Sequence: TTTTGTGATTGCTGTCATGCTT Locus tag: b1657 Name: ydhP Funciton: hypothetical protein
	b1657	ydhP	hypothetical protein
Position: -90 Score: 3.9 Sequence: ATATAAGAGCCAGCTCACAGTT Locus tag: b1729 Name: tcyP Funciton: L-cystine uptake protein TcyP
	b1729	tcyP	L-cystine uptake protein TcyP
Position: -137 Score: 5.2 Sequence: AAATGTGATTTTCATCACGATT Locus tag: b1778 Name: msrB Funciton: methionine sulfoxide reductase B Locus tag: b1777 Name: b1777 Funciton: conserved hypothetical protein
	b1778	msrB	methionine sulfoxide reductase B
	b1777	b1777	conserved hypothetical protein
Position: -98 Score: 4.2 Sequence: CTCCGTGATGCTCGTCACAAAT Locus tag: b1795 Name: yeaQ Funciton: Transglycosylase associated protein
	b1795	yeaQ	Transglycosylase associated protein
Position: -151 Score: 3.9 Sequence: AAATCTGACACTGATCATGTTA Locus tag: b1853 Name: hexR Funciton: Phosphogluconate repressor HexR, RpiR family
	b1853	hexR	Phosphogluconate repressor HexR, RpiR family
Position: -260 Score: 3.7 Sequence: AAATGTGACAAAAATTGACTTT Locus tag: b1915 Name: yecF Funciton: hypothetical protein
	b1915	yecF	hypothetical protein
Position: -43 Score: 4.6 Sequence: AATTGTGACATTTGTCATACAA Locus tag: b2063 Name: yegH Funciton: putative membrane protein
	b2063	yegH	putative membrane protein
Position: -158 Score: 3.7 Sequence: AAACGTGACCACGCCCGCAGAT Locus tag: b2181 Name: yejG Funciton: hypothetical protein
	b2181	yejG	hypothetical protein
Position: -263 Score: 3.6 Sequence: ATTTATGATTAACATCATGCAC Position: -54 Score: 4.1 Sequence: AGTTGTGAATTTGCACAAATTT Locus tag: b2295 Name: yfbV Funciton: putative cytoplasmic protein
	b2295	yfbV	putative cytoplasmic protein
Position: -109 Score: 4.1 Sequence: AATATCGATCTGGGTCACACAA Locus tag: b2389 Name: yfeO Funciton: Chloride channel protein
	b2389	yfeO	Chloride channel protein
Position: -246 Score: 3.8 Sequence: GTATGTGATACACAGCAACATT Locus tag: b2471 Name: yffB Funciton: FIG138056: a glutathione-dependent thiol reductase Locus tag: b2472 Name: dapE Funciton: N-succinyl-L,L-diaminopimelate desuccinylase (EC 3.5.1.18)
	b2471	yffB	FIG138056: a glutathione-dependent thiol reductase
	b2472	dapE	N-succinyl-L,L-diaminopimelate desuccinylase (EC 3.5.1.18)
Position: -81 Score: 4.8 Sequence: TTATGAGATTTTCATCACACAT Locus tag: b2597 Name: raiA Funciton: stationary phase translation inhibitor and ribosome stability factor
	b2597	raiA	stationary phase translation inhibitor and ribosome stability factor
Position: -125 Score: 4.2 Sequence: TTTATTGATTTAAATCAAAGAT Locus tag: b2579 Name: grcA Funciton: Autonomous glycyl radical cofactor
	b2579	grcA	Autonomous glycyl radical cofactor
Position: -166 Score: 3.7 Sequence: TTGTTTGATATTGTGAATATAA Position: -127 Score: 5.2 Sequence: TATGGTGATCTGATTCACATAA Locus tag: b2735 Name: ygbI Funciton: Hypothetical transcriptional regulator ygbI
	b2735	ygbI	Hypothetical transcriptional regulator ygbI
Position: -90 Score: 4.9 Sequence: TTATGTGAATCAGATCACCATA Locus tag: b2736 Name: ygbJ Funciton: D-beta-hydroxybutyrate dehydrogenase (EC 1.1.1.30) Locus tag: b2737 Name: ygbK Funciton: hypothetical protein
	b2736	ygbJ	D-beta-hydroxybutyrate dehydrogenase (EC 1.1.1.30)
	b2737	ygbK	hypothetical protein
Position: -228 Score: 4.6 Sequence: TTTTGTGATCTGCCGCAAATAG Locus tag: b3110 Name: yhaO Funciton: hypothetical protein Locus tag: b4470 Name: yhaM Funciton: hypothetical protein
	b3110	yhaO	hypothetical protein
	b4470	yhaM	hypothetical protein
Position: -91 Score: 3.7 Sequence: ATTTGTTACATGAATCAGTTAA Position: -69 Score: 4 Sequence: ATGTGTGATGCGTACCATTTTT Locus tag: b3209 Name: elbB Funciton: sigma cross-reacting protein 27A (SCRP-27A) Locus tag: b3208 Name: mtgA Funciton: monofunctional biosynthetic peptidoglycan transglycosylase
	b3209	elbB	sigma cross-reacting protein 27A (SCRP-27A)
	b3208	mtgA	monofunctional biosynthetic peptidoglycan transglycosylase
Position: -60 Score: 5.1 Sequence: TTTTGTGATATGGGTCACGAAA Locus tag: b3238 Name: yhcN Funciton: hypothetical protein
	b3238	yhcN	hypothetical protein
Position: -167 Score: 5.4 Sequence: AAAAGTGATTTAGATCACATAA Locus tag: b3242 Name: yhcR Funciton: hypothetical protein Locus tag: b3241 Name: aaeA Funciton: p-hydroxybenzoic acid efflux system component Locus tag: b3240 Name: aaeB Funciton: p-hydroxybenzoic acid efflux system component
	b3242	yhcR	hypothetical protein
	b3241	aaeA	p-hydroxybenzoic acid efflux system component
	b3240	aaeB	p-hydroxybenzoic acid efflux system component
Position: -155 Score: 4.5 Sequence: TTATGTGAAGCATTTCATAGAA Locus tag: b3523 Name: yhjE Funciton: Inner membrane metabolite transport protein YhjE
	b3523	yhjE	Inner membrane metabolite transport protein YhjE
Position: -175 Score: 4.1 Sequence: AAGTGTGCCGTAGTTCACGATC Locus tag: b3575 Name: yiaK Funciton: 3-dehydro-L-gulonate 2-dehydrogenase (EC 1.1.1.130) Locus tag: b3576 Name: yiaL Funciton: Protein YiaL Locus tag: b3577 Name: yiaM Funciton: 2,3-diketo-L-gulonate TRAP transporter small permease protein yiaM Locus tag: b3578 Name: yiaN Funciton: predicted transporter Locus tag: b3579 Name: yiaO Funciton: 2,3-diketo-L-gulonate-binding periplasmic protein yiaO precursor Locus tag: b3580 Name: lyxK Funciton: L-xylulose/3-keto-L-gulonate kinase (EC 2.7.1.-) Locus tag: b3581 Name: sgbH Funciton: 3-keto-L-gulonate 6-phosphate decarboxylase Locus tag: b3582 Name: sgbU Funciton: putative 3-hexulose-6-phosphate isomerase Locus tag: b3583 Name: sgbE Funciton: L-ribulose-5-phosphate 4-epimerase
	b3575	yiaK	3-dehydro-L-gulonate 2-dehydrogenase (EC 1.1.1.130)
	b3576	yiaL	Protein YiaL
	b3577	yiaM	2,3-diketo-L-gulonate TRAP transporter small permease protein yiaM
	b3578	yiaN	predicted transporter
	b3579	yiaO	2,3-diketo-L-gulonate-binding periplasmic protein yiaO precursor
	b3580	lyxK	L-xylulose/3-keto-L-gulonate kinase (EC 2.7.1.-)
	b3581	sgbH	3-keto-L-gulonate 6-phosphate decarboxylase
	b3582	sgbU	putative 3-hexulose-6-phosphate isomerase
	b3583	sgbE	L-ribulose-5-phosphate 4-epimerase
Position: -58 Score: 4.4 Sequence: AATCGTGACAATGCGCACAAAT Locus tag: b3646 Name: yicG Funciton: Putative inner membrane protein
	b3646	yicG	Putative inner membrane protein
Position: -56 Score: 4.1 Sequence: ATTTTTGAGCGGAATCGCGTTA Locus tag: b3697 Name: yidA Funciton: Phosphatase YidA
	b3697	yidA	Phosphatase YidA
Position: -266 Score: 4.2 Sequence: TTTTATGATGCGTTTAATAATT Locus tag: b3765 Name: yifB Funciton: magnesium chelatase family protein
	b3765	yifB	magnesium chelatase family protein
Position: -76 Score: 3.6 Sequence: AAAATTGACAGCCGTCACTTTT Locus tag: b3883 Name: yihV Funciton: Fructokinase (EC 2.7.1.4); Sugar kinase YihV Locus tag: b3884 Name: yihW Funciton: DeoR-type transcriptional regulator YihW
	b3883	yihV	Fructokinase (EC 2.7.1.4); Sugar kinase YihV
	b3884	yihW	DeoR-type transcriptional regulator YihW
Position: -149 Score: 5.7 Sequence: AATTGTGATATAGTTCACAAAA Locus tag: b4060 Name: yjcB Funciton: hypothetical protein
	b4060	yjcB	hypothetical protein
Position: -139 Score: 3.8 Sequence: AATTGTTACCTGGTACGCGATT Locus tag: b4190 Name: yjfP Funciton: putative hydrolase
	b4190	yjfP	putative hydrolase
Position: -231 Score: 5.7 Sequence: ATATGTGATATGAATCACATAT Locus tag: b4354 Name: cstA2 Funciton: Carbon starvation protein A paralog Locus tag: b4353 Name: yjiX Funciton: hypothetical protein Locus tag: b4352 Name: yjiA Funciton: ATP-binding protein
	b4354	cstA2	Carbon starvation protein A paralog
	b4353	yjiX	hypothetical protein
	b4352	yjiA	ATP-binding protein
Position: -183 Score: 3.9 Sequence: CACTTCGATACACATCACAATT Position: -130 Score: 5 Sequence: TAATGCGATCTGGTTCAAATAA Locus tag: b4380 Name: yjjI Funciton: hypothetical protein Locus tag: b4379 Name: yjjW Funciton: predicted pyruvate formate lyase activating enzyme
	b4380	yjjI	hypothetical protein
	b4379	yjjW	predicted pyruvate formate lyase activating enzyme
Position: -108 Score: 4.1 Sequence: AAATGTGCTGTTAATCACATGC Locus tag: b1594 Name: mlc Funciton: ROK family transcriptional regulatory protein
	b1594	mlc	ROK family transcriptional regulatory protein
Position: -68 Score: 4.9 Sequence: TAATGTGATCGGTAGCACGTTT Locus tag: b2141 Name: yohJ Funciton: LrgA family protein Locus tag: b2142 Name: yohK Funciton: LrgB family protein
	b2141	yohJ	LrgA family protein
	b2142	yohK	LrgB family protein
Position: -91 Score: 4.6 Sequence: CTTTGTGATAAAAATCACTTTT Locus tag: b2844 Name: yqeF Funciton: Acetyl-CoA acetyltransferase (EC 2.3.1.9)
	b2844	yqeF	Acetyl-CoA acetyltransferase (EC 2.3.1.9)
Position: -220 Score: 3.8 Sequence: TCCTGTGAAGTGTTTCACGTTG Locus tag: b3279 Name: yrdA Funciton: carbonic anhydrase, family 3
	b3279	yrdA	carbonic anhydrase, family 3
Position: -288 Score: 3.6 Sequence: TTGTGCGATATCGGACACGCTT Position: -123 Score: 3.8 Sequence: TACTGTGATGTGCTTAATGATG Locus tag: b3398 Name: igaA Funciton: IgaA: a membrane protein that prevents overactivation of the Rcs regulatory system
	b3398	igaA	IgaA: a membrane protein that prevents overactivation of the Rcs regulatory system
Position: -98 Score: 3.7 Sequence: AAGTGTGATGTAACGCAATCTG Locus tag: b4227 Name: ytfQ Funciton: Putative sugar ABC transport system, periplasmic binding protein YtfQ precursor Locus tag: b4485 Name: ytfR Funciton: Putative sugar ABC transport system, ATP-binding protein YtfR (EC 3.6.3.17) Locus tag: b4230 Name: ytfT Funciton: Putative sugar ABC transport system, permease protein YtfT Locus tag: b4231 Name: yjfF Funciton: Putative sugar ABC transport system, permease protein YjfF
	b4227	ytfQ	Putative sugar ABC transport system, periplasmic binding protein YtfQ precursor
	b4485	ytfR	Putative sugar ABC transport system, ATP-binding protein YtfR (EC 3.6.3.17)
	b4230	ytfT	Putative sugar ABC transport system, permease protein YtfT
	b4231	yjfF	Putative sugar ABC transport system, permease protein YjfF
Position: -208 Score: 3.9 Sequence: TAACATGATCAGTGTCAGATTT Locus tag: b1852 Name: zwf Funciton: Glucose-6-phosphate 1-dehydrogenase (EC 1.1.1.49)
	b1852	zwf	Glucose-6-phosphate 1-dehydrogenase (EC 1.1.1.49)
Position: -101 Score: 3.8 Sequence: TTATGTGCGCCGCCTCACGCAC Locus tag: b2153 Name: folE Funciton: GTP cyclohydrolase I Locus tag: b2152 Name: yeiB Funciton: conserved inner membrane protein
	b2153	folE	GTP cyclohydrolase I
	b2152	yeiB	conserved inner membrane protein
Position: -129 Score: 4.3 Sequence: TTTCGTGATCCAGTTAAAGTAA Locus tag: b3076 Name: ebgA Funciton: cryptic beta-D-galactosidase, alpha subunit Locus tag: b3077 Name: ebgC Funciton: cryptic beta-D-galactosidase, beta subunit
	b3076	ebgA	cryptic beta-D-galactosidase, alpha subunit
	b3077	ebgC	cryptic beta-D-galactosidase, beta subunit
Position: -156 Score: 3.7 Sequence: AAACGTTATATATGTCAAGTTG Position: -131 Score: 3.8 Sequence: AAATGTGCACAGTTTCATGATT Locus tag: b0113 Name: pdhR Funciton: Transcriptional repressor for pyruvate dehydrogenase complex Locus tag: b0114 Name: aceE Funciton: Pyruvate dehydrogenase E1 component (EC 1.2.4.1) Locus tag: b0115 Name: aceF Funciton: Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex (EC 2.3.1.12)
	b0113	pdhR	Transcriptional repressor for pyruvate dehydrogenase complex
	b0114	aceE	Pyruvate dehydrogenase E1 component (EC 1.2.4.1)
	b0115	aceF	Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex (EC 2.3.1.12)
Position: -225 Score: 3.4 Sequence: AATAGTTTCCTTGCTTACATTT Position: -203 Score: 3.4 Sequence: ATCTGTGTTAATAATAACACAG Position: -124 Score: 3.8 Sequence: AAGTGTGATCGGGGACAATATA Locus tag: b3049 Name: glgS Funciton: glycogen synthesis protein GlgS
	b3049	glgS	glycogen synthesis protein GlgS
Position: -253 Score: 4.6 Sequence: TATAGTGATCCACGCCACATTT Locus tag: b3172 Name: argG Funciton: Argininosuccinate synthase (EC 6.3.4.5)
	b3172	argG	Argininosuccinate synthase (EC 6.3.4.5)
Position: -241 Score: 5 Sequence: AAATTTGATTTGGATCACGTAA Locus tag: b1241 Name: adhE Funciton: Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
	b1241	adhE	Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
Position: -134 Score: 3.8 Sequence: AAGCAGGATTTAGCTCACACTT Locus tag: b0034 Name: caiF Funciton: transcriptional activator for carnitine metabolism
	b0034	caiF	transcriptional activator for carnitine metabolism
Position: -200 Score: 3.6 Sequence: GAATGAGACACGATTCAAAAAA Locus tag: b2942 Name: metK Funciton: S-adenosylmethionine synthetase (EC 2.5.1.6)
	b2942	metK	S-adenosylmethionine synthetase (EC 2.5.1.6)
Position: -104 Score: 3.4 Sequence: TTTAGTGAGGCATAAATCACAT Position: -102 Score: 3.9 Sequence: TAGTGAGGCATAAATCACATTA Position: -42 Score: 3.9 Sequence: AAACGTTTTATCTGTCACATAA Locus tag: b1620 Name: malI Funciton: Maltose regulon regulatory protein MalI (repressor for malXY)
	b1620	malI	Maltose regulon regulatory protein MalI (repressor for malXY)
Position: -146 Score: 3.5 Sequence: GATAACGATCTGGATCACATTC Position: -95 Score: 3.9 Sequence: TGCTGTGACTCGATTCACGAAG Locus tag: b2151 Name: galS Funciton: Mgl repressor and galactose ultrainduction factor GalS, HTH-type transcriptional regulator
	b2151	galS	Mgl repressor and galactose ultrainduction factor GalS, HTH-type transcriptional regulator
Position: -297 Score: 3.6 Sequence: TTTTATAAATGCGTTCAAAATA Position: -158 Score: 3.3 Sequence: TATTGTATTGTTTTTCAATGAA Position: -128 Score: 3.3 Sequence: ATTCGCGTAATATCTCACGATA Locus tag: b1493 Name: gadB Funciton: Glutamate decarboxylase (EC 4.1.1.15) Locus tag: b1492 Name: gadC Funciton: predicted glutamate:gamma-aminobutyric acid antiporter
	b1493	gadB	Glutamate decarboxylase (EC 4.1.1.15)
	b1492	gadC	predicted glutamate:gamma-aminobutyric acid antiporter
Position: -236 Score: 3.8 Sequence: AACAATGACCGACATCGCATAA Locus tag: b2232 Name: ubiG Funciton: 3-demethylubiquinone-9 3-methyltransferase (EC 2.1.1.64)
	b2232	ubiG	3-demethylubiquinone-9 3-methyltransferase (EC 2.1.1.64)
Position: -112 Score: 4.8 Sequence: ATTTGTGAATCTTTTCACAGTT Locus tag: b2146 Name: yeiT Funciton: predicted oxidoreductase Locus tag: b2147 Name: yeiA Funciton: putative oxidoreductase
	b2146	yeiT	predicted oxidoreductase
	b2147	yeiA	putative oxidoreductase
Position: -101 Score: 5.7 Sequence: TTATGTGATTTGTATCACATAA Position: -71 Score: 4.9 Sequence: TTTTGTGATGGTTGTCATATTA Locus tag: b4663 Name: azuC Funciton: hypothetical protein
	b4663	azuC	hypothetical protein
Position: -97 Score: 4.3 Sequence: ATTTGTGATTTTACTTAACTAT Position: -76 Score: 3.6 Sequence: TTGTGTAACTTTCATAAAACAA Position: -45 Score: 3.6 Sequence: TGTTTTTAATTAATTCACGAAA Locus tag: b1388 Name: paaA Funciton: predicted multicomponent oxygenase/reductase subunit for phenylacetic acid degradation Locus tag: b1389 Name: paaB Funciton: predicted multicomponent oxygenase/reductase subunit for phenylacetic acid degradation Locus tag: b1390 Name: paaC Funciton: predicted multicomponent oxygenase/reductase subunit for phenylacetic acid degradation Locus tag: b1391 Name: paaD Funciton: predicted multicomponent oxygenase/reductase subunit for phenylacetic acid degradation Locus tag: b1392 Name: paaE Funciton: predicted multicomponent oxygenase/reductase subunit for phenylacetic acid degradation Locus tag: b1393 Name: paaF Funciton: enoyl-CoA hydratase-isomerase Locus tag: b1394 Name: paaG Funciton: enoyl-CoA hydratase Locus tag: b1395 Name: paaH Funciton: 3-hydroxybutyryl-CoA dehydrogenase Locus tag: b1396 Name: paaI Funciton: predicted thioesterase Locus tag: b1397 Name: paaJ Funciton: acetyl-CoA acetyltransferase Locus tag: b1398 Name: paaK Funciton: phenylacetyl-CoA ligase
	b1388	paaA	predicted multicomponent oxygenase/reductase subunit for phenylacetic acid degradation
	b1389	paaB	predicted multicomponent oxygenase/reductase subunit for phenylacetic acid degradation
	b1390	paaC	predicted multicomponent oxygenase/reductase subunit for phenylacetic acid degradation
	b1391	paaD	predicted multicomponent oxygenase/reductase subunit for phenylacetic acid degradation
	b1392	paaE	predicted multicomponent oxygenase/reductase subunit for phenylacetic acid degradation
	b1393	paaF	enoyl-CoA hydratase-isomerase
	b1394	paaG	enoyl-CoA hydratase
	b1395	paaH	3-hydroxybutyryl-CoA dehydrogenase
	b1396	paaI	predicted thioesterase
	b1397	paaJ	acetyl-CoA acetyltransferase
	b1398	paaK	phenylacetyl-CoA ligase
Position: -93 Score: 3.5 Sequence: GAGTGCGAGTCTGCTCGCATAA Locus tag: b2009 Name: sbmC Funciton: DNA gyrase inhibitor
	b2009	sbmC	DNA gyrase inhibitor
Position: -155 Score: 4.8 Sequence: TTGTGTGATGCAAGCCACATTT Locus tag: b0907 Name: serC Funciton: Phosphoserine aminotransferase (EC 2.6.1.52) Locus tag: b0908 Name: aroA Funciton: 5-Enolpyruvylshikimate-3-phosphate synthase (EC 2.5.1.19)
	b0907	serC	Phosphoserine aminotransferase (EC 2.6.1.52)
	b0908	aroA	5-Enolpyruvylshikimate-3-phosphate synthase (EC 2.5.1.19)
Position: -107 Score: 3.7 Sequence: ATATGCGTTTCAGTTAACGTTT Locus tag: b0330 Name: prpR Funciton: Propionate catabolism operon regulatory protein PrpR
	b0330	prpR	Propionate catabolism operon regulatory protein PrpR
Position: -224 Score: 3.3 Sequence: AATTGTTAACAATTTTGTAAAA Locus tag: b0116 Name: lpdA Funciton: Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
	b0116	lpdA	Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
Position: -145 Score: 3.2 Sequence: CTTCGTAACGCCTCGCAAATTT Locus tag: b0108 Name: ppdD Funciton: predicted major pilin subunit Locus tag: b0107 Name: pulE Funciton: conserved protein with nucleoside triphosphate hydrolase domain
	b0108	ppdD	predicted major pilin subunit
	b0107	pulE	conserved protein with nucleoside triphosphate hydrolase domain
Position: -144 Score: 3.5 Sequence: TTTTGTAAACAGATTAACACCT Locus tag: b0118 Name: acnB Funciton: Aconitate hydratase 2 (EC 4.2.1.3)
	b0118	acnB	Aconitate hydratase 2 (EC 4.2.1.3)
Position: -181 Score: 4.5 Sequence: TAATGCGATCTATATCACGCTG Position: -140 Score: 3.4 Sequence: TTTTTTGATCGCGGTGTCAGTT Locus tag: b1617 Name: uidA Funciton: Beta-glucuronidase (EC 3.2.1.31) Locus tag: b1616 Name: uidB Funciton: Glucuronide transporter UidB Locus tag: b1615 Name: uidC Funciton: outer membrane porin protein
	b1617	uidA	Beta-glucuronidase (EC 3.2.1.31)
	b1616	uidB	Glucuronide transporter UidB
	b1615	uidC	outer membrane porin protein
Position: -261 Score: 3.6 Sequence: TTTCGTGAATTAATTAAAAACA Position: -175 Score: 3.7 Sequence: AACTGTGACGGATTTCGCACCC Position: -109 Score: 3.8 Sequence: AGTTGCTATACAGATCGCATAG Locus tag: b1387 Name: paaN Funciton: Phenylacetic acid degradation protein PaaN, ring-opening aldehyde dehydrogenase (EC 1.2.1.3)
	b1387	paaN	Phenylacetic acid degradation protein PaaN, ring-opening aldehyde dehydrogenase (EC 1.2.1.3)
Position: -153 Score: 3.7 Sequence: AAACGTTAACTGAAACGCATAT Locus tag: b0331 Name: prpB Funciton: Methylisocitrate lyase (EC 4.1.3.30)
	b0331	prpB	Methylisocitrate lyase (EC 4.1.3.30)
Position: -87 Score: 4.1 Sequence: AACTGTGGTTGCCATCACAGAT Locus tag: b1512 Name: lsrR Funciton: LsrR, transcriptional repressor of lsr operon Locus tag: b1511 Name: ydeV Funciton: putative kinase
	b1512	lsrR	LsrR, transcriptional repressor of lsr operon
	b1511	ydeV	putative kinase
Position: -201 Score: 3.4 Sequence: TTGCGTGCTGTTTTCCAGAATT Locus tag: b1421 Name: trg Funciton: Methyl-accepting chemotaxis protein III (ribose and galactose chemoreceptor protein)
	b1421	trg	Methyl-accepting chemotaxis protein III (ribose and galactose chemoreceptor protein)
Position: -106 Score: 3.5 Sequence: TTTCTTGCTTACCGTCACATTC Locus tag: b1761 Name: gdhA Funciton: NADP-specific glutamate dehydrogenase (EC 1.4.1.4)
	b1761	gdhA	NADP-specific glutamate dehydrogenase (EC 1.4.1.4)
Position: -201 Score: 3.9 Sequence: TTTAGTTACATGTTTAACACTT Position: -134 Score: 3.3 Sequence: TAGTTTTATATTTTACCCATTT Locus tag: b1040 Name: csgD Funciton: DNA-binding transcriptional activator in two-component regulatory system Locus tag: b1039 Name: csgE Funciton: hypothetical protein Locus tag: b1038 Name: csgF Funciton: hypothetical protein Locus tag: b1037 Name: csgG Funciton: outer membrane lipoprotein
	b1040	csgD	DNA-binding transcriptional activator in two-component regulatory system
	b1039	csgE	hypothetical protein
	b1038	csgF	hypothetical protein
	b1037	csgG	outer membrane lipoprotein
Position: -213 Score: 3.9 Sequence: AATAGTGACCTCGCGCAAAATG Locus tag: b0440 Name: hupB Funciton: HU, DNA-binding transcriptional regulator, beta subunit
	b0440	hupB	HU, DNA-binding transcriptional regulator, beta subunit
Position: -36 Score: 3.2 Sequence: AGTTGCAATTCGTGGCAAAAAT Locus tag: b0584 Name: fepA Funciton: iron-enterobactin outer membrane transporter Locus tag: b0583 Name: entD Funciton: 4'-phosphopantetheinyl transferase (EC 2.7.8.-) [enterobactin] siderophore
	b0584	fepA	iron-enterobactin outer membrane transporter
	b0583	entD	4'-phosphopantetheinyl transferase (EC 2.7.8.-) [enterobactin] siderophore
Position: -172 Score: 4 Sequence: AGGTGTTAAATTGATCACGTTT Locus tag: b3806 Name: cyaA Funciton: Adenylate cyclase (EC 4.6.1.1)
	b3806	cyaA	Adenylate cyclase (EC 4.6.1.1)
Position: -94 Score: 5 Sequence: GATTGTGATTCGATTCACATTT Locus tag: b3707 Name: tnaC Funciton: tryptophanase leader peptide Locus tag: b3708 Name: tnaA Funciton: Tryptophanase (EC 4.1.99.1) Locus tag: b3709 Name: tnaB Funciton: Low affinity tryptophan permease
	b3707	tnaC	tryptophanase leader peptide
	b3708	tnaA	Tryptophanase (EC 4.1.99.1)
	b3709	tnaB	Low affinity tryptophan permease
Position: -145 Score: 4.8 Sequence: AAGCGTGATGCATCTCACCTTT Locus tag: b3666 Name: uhpT Funciton: Hexose phosphate transport protein UhpT
	b3666	uhpT	Hexose phosphate transport protein UhpT
Position: -157 Score: 4.8 Sequence: ATTTGTGATGAAGATCACGTCA Position: -107 Score: 4 Sequence: TAACGTGATGTGCCTTGTAATT Locus tag: b4268 Name: idnK Funciton: D-gluconate kinase, thermosensitive
	b4268	idnK	D-gluconate kinase, thermosensitive
Position: -187 Score: 4.2 Sequence: TAATGTGACGTCCTTTGCATAC Locus tag: b3356 Name: yhfA Funciton: hypothetical protein
	b3356	yhfA	hypothetical protein
Position: -94 Score: 3.7 Sequence: ATTCGTGATAGCTGTCGTAAAG Locus tag: b3588 Name: aldB Funciton: Aldehyde dehydrogenase B (EC 1.2.1.22)
	b3588	aldB	Aldehyde dehydrogenase B (EC 1.2.1.22)
Position: -47 Score: 3.7 Sequence: GATCGTGAACTACGGCACACTT Locus tag: b3574 Name: yiaJ Funciton: Hypothetical transcriptional regulator yiaJ, IclR family
	b3574	yiaJ	Hypothetical transcriptional regulator yiaJ, IclR family
Position: -182 Score: 3.6 Sequence: ATCCGTGCCCCATCTCCCATTT Locus tag: b3453 Name: ugpB Funciton: Glycerol-3-phosphate ABC transporter, periplasmic glycerol-3-phosphate-binding protein (TC 3.A.1.1.3) Locus tag: b3452 Name: ugpA Funciton: SN-glycerol-3-phosphate transport system permease protein UgpA (TC 3.A.1.1.3) Locus tag: b3451 Name: ugpE Funciton: SN-glycerol-3-phosphate transport system permease protein UgpE (TC 3.A.1.1.3) Locus tag: b3450 Name: ugpC Funciton: SN-glycerol-3-phosphate transport ATP-binding protein UgpC (TC 3.A.1.1.3) Locus tag: b3449 Name: ugpQ Funciton: Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46)
	b3453	ugpB	Glycerol-3-phosphate ABC transporter, periplasmic glycerol-3-phosphate-binding protein (TC 3.A.1.1.3)
	b3452	ugpA	SN-glycerol-3-phosphate transport system permease protein UgpA (TC 3.A.1.1.3)
	b3451	ugpE	SN-glycerol-3-phosphate transport system permease protein UgpE (TC 3.A.1.1.3)
	b3450	ugpC	SN-glycerol-3-phosphate transport ATP-binding protein UgpC (TC 3.A.1.1.3)
	b3449	ugpQ	Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46)
Position: -236 Score: 4.3 Sequence: TAATATGACCAACCTCTCATAA Locus tag: b3415 Name: gntT Funciton: gluconate transporter
	b3415	gntT	gluconate transporter
Position: -124 Score: 3.2 Sequence: AAAATTTATACAAATCAGCAAT Position: -76 Score: 3.4 Sequence: GAATTTGATTTACATCAATAAG Locus tag: b3365 Name: nirB Funciton: nitrite reductase (NAD(P)H) subunit Locus tag: b3366 Name: nirD Funciton: nitrite reductase small subunit Locus tag: b3367 Name: nirC Funciton: nitrite transporter NirC
	b3365	nirB	nitrite reductase (NAD(P)H) subunit
	b3366	nirD	nitrite reductase small subunit
	b3367	nirC	nitrite transporter NirC
Position: -124 Score: 3.8 Sequence: ATTTGCGGGTCGCGTCACATTT Position: -87 Score: 3.8 Sequence: TGTTGTGATTACTTTTGAAAAT Locus tag: b4193 Name: ulaA Funciton: Ascorbate-specific PTS system, EIIC component Locus tag: b4194 Name: ulaB Funciton: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69) Locus tag: b4195 Name: ulaC Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-) Locus tag: b4196 Name: ulaD Funciton: 3-keto-L-gulonate-6-phosphate decarboxylase UlaD (EC 4.1.1.85) (L-ascorbate utilization protein D) Locus tag: b4197 Name: ulaE Funciton: L-ribulose-5-phosphate 3-epimerase UlaE (EC 5.1.3.22) (L-ascorbate utilization protein E) Locus tag: b4198 Name: ulaF Funciton: L-ribulose-5-phosphate 4-epimerase UlaF (EC 5.1.3.4) (L-ascorbate utilization protein F)
	b4193	ulaA	Ascorbate-specific PTS system, EIIC component
	b4194	ulaB	Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
	b4195	ulaC	Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
	b4196	ulaD	3-keto-L-gulonate-6-phosphate decarboxylase UlaD (EC 4.1.1.85) (L-ascorbate utilization protein D)
	b4197	ulaE	L-ribulose-5-phosphate 3-epimerase UlaE (EC 5.1.3.22) (L-ascorbate utilization protein E)
	b4198	ulaF	L-ribulose-5-phosphate 4-epimerase UlaF (EC 5.1.3.4) (L-ascorbate utilization protein F)
Position: -53 Score: 3.5 Sequence: GACTGTGATCTATTCAGCAAAA Locus tag: b4123 Name: dcuB Funciton: C4-dicarboxylate transporter DcuB
	b4123	dcuB	C4-dicarboxylate transporter DcuB
Position: -227 Score: 5.1 Sequence: ATGTGTGAAGTTGATCACAAAT Locus tag: b4111 Name: proP Funciton: L-Proline/Glycine betaine transporter ProP
	b4111	proP	L-Proline/Glycine betaine transporter ProP
Position: -117 Score: 3.6 Sequence: AATTGTTTTTGATTTTGCATTT Locus tag: b4014 Name: aceB Funciton: malate synthase A Locus tag: b4015 Name: aceA Funciton: isocitrate lyase
	b4014	aceB	malate synthase A
	b4015	aceA	isocitrate lyase
Position: -255 Score: 3.6 Sequence: TTTCGTGTTCCGTTTCATGGTT Locus tag: b4003 Name: zraS Funciton: Sensory histidine kinase in two-component regulatory system with ZraR Locus tag: b4004 Name: zraR Funciton: Response regulator of zinc sigma-54-dependent two-component system
	b4003	zraS	Sensory histidine kinase in two-component regulatory system with ZraR
	b4004	zraR	Response regulator of zinc sigma-54-dependent two-component system
Position: -179 Score: 3.4 Sequence: AAACGTGATTTAACGCCTGATT Locus tag: b4000 Name: hupA Funciton: DNA-binding protein HU-alpha (HU-2)
	b4000	hupA	DNA-binding protein HU-alpha (HU-2)
Position: -206 Score: 4.5 Sequence: TTTTGTGATGAACGTCACGTCA Position: -162 Score: 5.4 Sequence: TTATGTGATTGATATCACACAA Position: -113 Score: 3.3 Sequence: TTCAGTGCCAGATTTCGCAGTA Locus tag: b3599 Name: mtlA Funciton: PTS system, mannitol-specific IIC component (EC 2.7.1.69) / PTS system, mannitol-specific IIB component (EC 2.7.1.69) / PTS system, mannitol-specific IIA component (EC 2.7.1.69) Locus tag: b3600 Name: mtlD Funciton: Mannitol-1-phosphate 5-dehydrogenase (EC 1.1.1.17) Locus tag: b3601 Name: mtlR Funciton: Mannitol operon repressor
	b3599	mtlA	PTS system, mannitol-specific IIC component (EC 2.7.1.69) / PTS system, mannitol-specific IIB component (EC 2.7.1.69) / PTS system, mannitol-specific IIA component (EC 2.7.1.69)
	b3600	mtlD	Mannitol-1-phosphate 5-dehydrogenase (EC 1.1.1.17)
	b3601	mtlR	Mannitol operon repressor

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Crp in Escherichia coli str. K-12 substr. MG1655

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --