Regulon of Crp in Erwinia amylovora ATCC 49946

Properties
Regulator type:	Transcription factor
TF locus tag:	EAM_3225
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Carbon catabolism
Effector:	Cyclic 3',5'-AMP
Regulog:	Crp - Enterobacteriales
Statistics of regulated genes:
- Genes	140
- Operons	73
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2301 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - CRP
By effector - Cyclic 3',5'-AMP
By pathway - Carbon catabolism

Regulated operons
	Locus Tag	Name	Function
Position: -194 Score: 3.9 Sequence: TTTTGTTAAGCAGATCTCTTTT Locus tag: EAM_2348 Name: fadL Funciton: Long-chain fatty acid transport protein
	EAM_2348	fadL	Long-chain fatty acid transport protein
Position: -198 Score: 3.3 Sequence: TAAAGCGATCGGATTTAACAAT Locus tag: EAM_0746 Name: pdhR Funciton: Transcriptional repressor for pyruvate dehydrogenase complex Locus tag: EAM_0747 Name: aceE Funciton: Pyruvate dehydrogenase E1 component (EC 1.2.4.1) Locus tag: EAM_0748 Name: aceF Funciton: Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex (EC 2.3.1.12)
	EAM_0746	pdhR	Transcriptional repressor for pyruvate dehydrogenase complex
	EAM_0747	aceE	Pyruvate dehydrogenase E1 component (EC 1.2.4.1)
	EAM_0748	aceF	Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex (EC 2.3.1.12)
Position: -37 Score: 5.3 Sequence: AAATGTGATCTAAATCACTTTT Locus tag: EAM_3128 Name: aaeR Funciton: LysR-family transcriptional regulator
	EAM_3128	aaeR	LysR-family transcriptional regulator
Position: -98 Score: 3.9 Sequence: CTGCGTGATCTGCCGCGCAAAA Locus tag: EAM_0327 Name: acs Funciton: acetyl-coenzyme A synthetase Locus tag: EAM_0326 Name: yjcH Funciton: membrane protein Locus tag: EAM_0325 Name: actP Funciton: acetate permease
	EAM_0327	acs	acetyl-coenzyme A synthetase
	EAM_0326	yjcH	membrane protein
	EAM_0325	actP	acetate permease
Position: -131 Score: 4.1 Sequence: ACATATGAAGGCCATCACATAA Locus tag: EAM_1697 Name: araB Funciton: L-ribulokinase Locus tag: EAM_1696 Name: araA Funciton: L-arabinose isomerase
	EAM_1697	araB	L-ribulokinase
	EAM_1696	araA	L-arabinose isomerase
Position: -251 Score: 4.3 Sequence: TTATGTGATGGCCTTCATATGT Locus tag: EAM_1698 Name: araF Funciton: L-arabinose-binding periplasmic protein Locus tag: EAM_1699 Name: araG Funciton: L-arabinose transporter ATP-binding protein Locus tag: EAM_1700 Name: araH Funciton: L-arabinose transporter permease protein
	EAM_1698	araF	L-arabinose-binding periplasmic protein
	EAM_1699	araG	L-arabinose transporter ATP-binding protein
	EAM_1700	araH	L-arabinose transporter permease protein
Position: -66 Score: 3.8 Sequence: TATTGTATTTTTATTCACTATT Locus tag: EAM_0137 Name: argE Funciton: acetylornithine deacetylase
	EAM_0137	argE	acetylornithine deacetylase
Position: -91 Score: 3.8 Sequence: ATTTGCAATTTGCATAAAAATT Locus tag: EAM_3122 Name: argR Funciton: arginine repressor
	EAM_3122	argR	arginine repressor
Position: -228 Score: 4.2 Sequence: CAATGTGACCTGGAACAGATAT Locus tag: EAM_0416 Name: aspA Funciton: aspartate ammonia-lyase Locus tag: EAM_0415 Name: dcuA Funciton: anaerobic C-4-dicarboxylate symporter
	EAM_0416	aspA	aspartate ammonia-lyase
	EAM_0415	dcuA	anaerobic C-4-dicarboxylate symporter
Position: -69 Score: 4.3 Sequence: ATTTTTAACCTTCATCACACTT Locus tag: EAM_1606 Name: astC Funciton: bifunctional succinylornithine transaminase/acetylornithine transaminase Locus tag: EAM_1607 Name: astA Funciton: arginine succinyltransferase Locus tag: EAM_1608 Name: astD Funciton: succinylglutamic semialdehyde dehydrogenase Locus tag: EAM_1609 Name: astB Funciton: succinylarginine dihydrolase Locus tag: EAM_1610 Name: astE Funciton: succinylglutamate desuccinylase
	EAM_1606	astC	bifunctional succinylornithine transaminase/acetylornithine transaminase
	EAM_1607	astA	arginine succinyltransferase
	EAM_1608	astD	succinylglutamic semialdehyde dehydrogenase
	EAM_1609	astB	succinylarginine dihydrolase
	EAM_1610	astE	succinylglutamate desuccinylase
Position: -264 Score: 4.4 Sequence: ATTTGTGATCGTGGACACGCTT Locus tag: EAM_3481 Name: atpI Funciton: ATP synthase subunit I Locus tag: EAM_3480 Name: atpB Funciton: ATP synthase subunit A Locus tag: EAM_3479 Name: atpE Funciton: ATP synthase subunit C Locus tag: EAM_3478 Name: atpF Funciton: ATP synthase subunit B Locus tag: EAM_3477 Name: atpH Funciton: ATP synthase subunit D Locus tag: EAM_3476 Name: atpA Funciton: ATP synthase subunit A Locus tag: EAM_3475 Name: atpG Funciton: ATP synthase subunit C Locus tag: EAM_3474 Name: atpD Funciton: ATP synthase subunit B Locus tag: EAM_3473 Name: atpC Funciton: ATP synthase epsilon subunit
	EAM_3481	atpI	ATP synthase subunit I
	EAM_3480	atpB	ATP synthase subunit A
	EAM_3479	atpE	ATP synthase subunit C
	EAM_3478	atpF	ATP synthase subunit B
	EAM_3477	atpH	ATP synthase subunit D
	EAM_3476	atpA	ATP synthase subunit A
	EAM_3475	atpG	ATP synthase subunit C
	EAM_3474	atpD	ATP synthase subunit B
	EAM_3473	atpC	ATP synthase epsilon subunit
Position: -129 Score: 3.8 Sequence: TGATGTAATGAGCAACAAATAA Position: -101 Score: 4.4 Sequence: AAGTTTGATGTGGCTAAAATTA Locus tag: EAM_2082 Name: yedJ Funciton: hypothetical protein
	EAM_2082	yedJ	hypothetical protein
Position: -124 Score: 3.9 Sequence: ACTTGCGATAAGTCTCTCATTT Position: -104 Score: 4.1 Sequence: TTTGGTGATGCATTTCATTTAT Position: -74 Score: 4.7 Sequence: TAGAGCGATTTAGATCACATAT Locus tag: EAM_2202 Name: cdd Funciton: cytidine deaminase
	EAM_2202	cdd	cytidine deaminase
Position: -161 Score: 4 Sequence: AAATTTGAAGCAGTTAACGCTA Position: -132 Score: 4.5 Sequence: TTTTGTGATAGAGGTCGCTATT Locus tag: EAM_1320 Name: clpS Funciton: ATP-dependent Clp protease adaptor protein Locus tag: EAM_1321 Name: clpA Funciton: ATP-dependent CLP protease ATP-binding subunit
	EAM_1320	clpS	ATP-dependent Clp protease adaptor protein
	EAM_1321	clpA	ATP-dependent CLP protease ATP-binding subunit
Position: -75 Score: 4.4 Sequence: TCGTGTGATCTGCGCCACATTA Locus tag: EAM_0727 Name: coaE Funciton: dephospho-CoA kinase Locus tag: EAM_0726 Name: yacF Funciton: hypothetical protein Locus tag: EAM_0725 Name: yacG Funciton: zinc-binding protein
	EAM_0727	coaE	dephospho-CoA kinase
	EAM_0726	yacF	hypothetical protein
	EAM_0725	yacG	zinc-binding protein
Position: -113 Score: 3.6 Sequence: AAAAACGATATTTATCACTTTT Locus tag: EAM_1116 Name: cspE Funciton: cold shock protein E
	EAM_1116	cspE	cold shock protein E
Position: -134 Score: 4 Sequence: AGTTGTGACAGCGTTTGCAAAA Locus tag: EAM_0985 Name: cyoA Funciton: cytochrome o ubiquinol oxidase subunit II Locus tag: EAM_0984 Name: cyoB Funciton: cytochrome o ubiquinol oxidase subunit I Locus tag: EAM_0983 Name: cyoC Funciton: cytochrome o ubiquinol oxidase subunit III Locus tag: EAM_0982 Name: cyoD Funciton: cytochrome o ubiquinol oxidase subunit IV Locus tag: EAM_0981 Name: cyoE Funciton: protoheme IX farnesyltransferase
	EAM_0985	cyoA	cytochrome o ubiquinol oxidase subunit II
	EAM_0984	cyoB	cytochrome o ubiquinol oxidase subunit I
	EAM_0983	cyoC	cytochrome o ubiquinol oxidase subunit III
	EAM_0982	cyoD	cytochrome o ubiquinol oxidase subunit IV
	EAM_0981	cyoE	protoheme IX farnesyltransferase
Position: -158 Score: 4.2 Sequence: AAATGTGACACAGCACGAATAA Locus tag: EAM_0455 Name: cysQ Funciton: PAPS (adenosine 3'-phosphate 5'-phosphosulfate) 3'(2'),5'-bisphosphate nucleotidase
	EAM_0455	cysQ	PAPS (adenosine 3'-phosphate 5'-phosphosulfate) 3'(2'),5'-bisphosphate nucleotidase
Position: -134 Score: 4.4 Sequence: TGAAGTGATTCAGCTCATAAAA Locus tag: EAM_3380 Name: dctA Funciton: C4-dicarboxylate transport protein
	EAM_3380	dctA	C4-dicarboxylate transport protein
Position: -99 Score: 4.8 Sequence: TAATTTGAGCCGGTTCACACTT Locus tag: EAM_3065 Name: deaD Funciton: ATP-independent RNA helicase
	EAM_3065	deaD	ATP-independent RNA helicase
Position: -233 Score: 4.6 Sequence: TGATGTGATAATTCTAACATTA Locus tag: EAM_0615 Name: deoC Funciton: 2-deoxyribose-5-phosphate aldolase Locus tag: EAM_0616 Name: deoA Funciton: thymidine phosphorylase Locus tag: EAM_0617 Name: deoB Funciton: phosphopentomutase Locus tag: EAM_0618 Name: deoD Funciton: purine nucleoside phosphorylase
	EAM_0615	deoC	2-deoxyribose-5-phosphate aldolase
	EAM_0616	deoA	thymidine phosphorylase
	EAM_0617	deoB	phosphopentomutase
	EAM_0618	deoD	purine nucleoside phosphorylase
Position: -103 Score: 3.4 Sequence: TTTTGTGACCTGCCTTAAAAGC Locus tag: EAM_2496 Name: csiE Funciton: Stationary phase inducible protein CsiE
	EAM_2496	csiE	Stationary phase inducible protein CsiE
Position: -219 Score: 4 Sequence: TATTGTTAACTTGCTCACAAGA Locus tag: EAM_3146 Name: dusB Funciton: tRNA-dihydrouridine synthase B Locus tag: EAM_3147 Name: fis Funciton: DNA-binding protein Fis
	EAM_3146	dusB	tRNA-dihydrouridine synthase B
	EAM_3147	fis	DNA-binding protein Fis
Position: -208 Score: 4.1 Sequence: TTTTGTGACGCAGATCGAAAGT Locus tag: EAM_2813 Name: epd Funciton: D-erythrose 4-phosphate dehydrogenase Locus tag: EAM_2812 Name: pgk Funciton: phosphoglycerate kinase
	EAM_2813	epd	D-erythrose 4-phosphate dehydrogenase
	EAM_2812	pgk	phosphoglycerate kinase
Position: -164 Score: 3.6 Sequence: AATTGTTATCATCTTATCACAG Position: -116 Score: 4 Sequence: AGTTGTGAACCTGCCCGCAAAT Locus tag: EAM_0213 Name: fadB Funciton: 4-enzyme protein: 3-hydroxyacyl-CoA dehydrogenase; 3-hydroxybutyryl-CoA epimerase; delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase; enoyl-CoA hydratase
	EAM_0213	fadB	4-enzyme protein: 3-hydroxyacyl-CoA dehydrogenase; 3-hydroxybutyryl-CoA epimerase; delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase; enoyl-CoA hydratase
Position: -130 Score: 3.9 Sequence: TTTAGTGATGCGCTTCGCAACC Locus tag: EAM_1956 Name: fadD Funciton: long-chain-fatty-acid--CoA ligase Locus tag: EAM_1955 Name: rnd Funciton: ribonuclease D
	EAM_1956	fadD	long-chain-fatty-acid--CoA ligase
	EAM_1955	rnd	ribonuclease D
Position: -169 Score: 3.8 Sequence: AACCGTGACTGAGATCGCTAAA Locus tag: EAM_0507 Name: fadH Funciton: 2,4-dienoyl-CoA reductase [NADPH] (2,4-dienoyl coenzyme A reductase)
	EAM_0507	fadH	2,4-dienoyl-CoA reductase [NADPH] (2,4-dienoyl coenzyme A reductase)
Position: -179 Score: 4.4 Sequence: AAATGTGCTGGCTGTCAAAAAT Locus tag: EAM_2223 Name: fruB Funciton: PTS system, fructose-specific IIA/FPr component Locus tag: EAM_2222 Name: fruK Funciton: 1-phosphofructokinase Locus tag: EAM_2221 Name: fruA Funciton: PTS system, fructose-specific IIBC component
	EAM_2223	fruB	PTS system, fructose-specific IIA/FPr component
	EAM_2222	fruK	1-phosphofructokinase
	EAM_2221	fruA	PTS system, fructose-specific IIBC component
Position: -161 Score: 3.9 Sequence: ATATCTGTTCCAGGTCACATTG Locus tag: EAM_0417 Name: fxsA Funciton: suppressor of F plamsid exlusion of phage T7
	EAM_0417	fxsA	suppressor of F plamsid exlusion of phage T7
Position: -152 Score: 4.1 Sequence: TCATGTGATCTGTCGCACAGTC Locus tag: EAM_2827 Name: galP Funciton: sugar transporter
	EAM_2827	galP	sugar transporter
Position: -215 Score: 5.4 Sequence: AATTGTGATGCAGATCACCATT Locus tag: EAM_1931 Name: gapA Funciton: glyceraldehyde-3-phosphate dehydrogenase Locus tag: EAM_1932 Name: yeaD Funciton: Aldose 1-epimerase
	EAM_1931	gapA	glyceraldehyde-3-phosphate dehydrogenase
	EAM_1932	yeaD	Aldose 1-epimerase
Position: -124 Score: 4 Sequence: AGACGTTATCGGCATCACGCAT Locus tag: EAM_3265 Name: glpD Funciton: glycerol-3-phosphate dehydrogenase
	EAM_3265	glpD	glycerol-3-phosphate dehydrogenase
Position: -134 Score: 3.9 Sequence: ATGCGTGATGCCGATAACGTCT Locus tag: EAM_3264 Name: glpE Funciton: thiosulfate sulfurtransferase Locus tag: EAM_3263 Name: glpG Funciton: predicted intramembrane serine protease Locus tag: EAM_3262 Name: glpR2 Funciton: DNA-binding transcriptional repressor
	EAM_3264	glpE	thiosulfate sulfurtransferase
	EAM_3263	glpG	predicted intramembrane serine protease
	EAM_3262	glpR2	DNA-binding transcriptional repressor
Position: -146 Score: 4.1 Sequence: TTTCATGACGCGGTACACATTT Locus tag: EAM_0119 Name: glpF Funciton: facilitator for glycerol uptake Locus tag: EAM_0118 Name: glpK Funciton: glycerol kinase
	EAM_0119	glpF	facilitator for glycerol uptake
	EAM_0118	glpK	glycerol kinase
Position: -240 Score: 3.7 Sequence: AAACGCGATGCGGTTAACGATG Position: -147 Score: 3.7 Sequence: ATTTGTGCCTCTCTTCACGGTC Locus tag: EAM_0195 Name: glpT Funciton: glycerol-3-phosphate transporter
	EAM_0195	glpT	glycerol-3-phosphate transporter
Position: -129 Score: 4.6 Sequence: TTTTTTGACAGTCTTCACACTT Locus tag: EAM_3275 Name: gntK Funciton: gluconate kinase 1 Locus tag: EAM_3274 Name: gntU Funciton: Low-affinity gluconate transporter (Gluconate permease)
	EAM_3275	gntK	gluconate kinase 1
	EAM_3274	gntU	Low-affinity gluconate transporter (Gluconate permease)
Position: -121 Score: 3.8 Sequence: TTTTGTGACAAAGCTGGCACAA Locus tag: EAM_1254 Name: hutH Funciton: histidine ammonia-lyase Locus tag: EAM_1253 Name: hutU Funciton: urocanate hydratase
	EAM_1254	hutH	histidine ammonia-lyase
	EAM_1253	hutU	urocanate hydratase
Position: -94 Score: 3.8 Sequence: TGTTGCGATAGCCATCACATCC Locus tag: EAM_0926 Name: lacZ Funciton: beta-D-galactosidase
	EAM_0926	lacZ	beta-D-galactosidase
Position: -56 Score: 3.6 Sequence: TTGTGTAATACTTGTAACGCTA Locus tag: EAM_1656 Name: lpp Funciton: major outer membrane lipoprotein
	EAM_1656	lpp	major outer membrane lipoprotein
Position: -54 Score: 3.9 Sequence: TAAGGTGTTTGTGCTCACCTTT Locus tag: EAM_3261 Name: malP Funciton: maltodextrin phosphorylase Locus tag: EAM_3260 Name: malQ Funciton: 4-alpha-glucanotransferase
	EAM_3261	malP	maltodextrin phosphorylase
	EAM_3260	malQ	4-alpha-glucanotransferase
Position: -195 Score: 4.9 Sequence: ATATGTGATTAAAGTCACCTTA Locus tag: EAM_1147 Name: nagB Funciton: Glucosamine-6-phosphate deaminase (EC 3.5.99.6) Locus tag: EAM_1146 Name: nagA Funciton: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25) Locus tag: EAM_1145 Name: nagC Funciton: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family Locus tag: EAM_1144 Name: nagD Funciton: Phosphatase NagD predicted to act in N-acetylglucosamine utilization subsystem
	EAM_1147	nagB	Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
	EAM_1146	nagA	N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
	EAM_1145	nagC	N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
	EAM_1144	nagD	Phosphatase NagD predicted to act in N-acetylglucosamine utilization subsystem
Position: -161 Score: 4.8 Sequence: TAAGGTGACTTTAATCACATAT Locus tag: EAM_1148 Name: nagE Funciton: PTS system, N-acetylglucosamine-specific IIA component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)
	EAM_1148	nagE	PTS system, N-acetylglucosamine-specific IIA component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)
Position: -55 Score: 3.7 Sequence: TAAGGTTATTTTATTAACCTTT Locus tag: EAM_1473 Name: ndh Funciton: NADH dehydrogenase (EC 1.6.99.3)
	EAM_1473	ndh	NADH dehydrogenase (EC 1.6.99.3)
Position: -153 Score: 5 Sequence: TAACGTGATCTAAATCACTTTT Locus tag: EAM_3229 Name: ppiA Funciton: Peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)
	EAM_3229	ppiA	Peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)
Position: -162 Score: 4.6 Sequence: AAACGTGATAGCCATCAAACAA Locus tag: EAM_1466 Name: ptsG Funciton: PTS system, glucose-specific IIB component (EC 2.7.1.69) / PTS system, glucose-specific IIC component (EC 2.7.1.69)
	EAM_1466	ptsG	PTS system, glucose-specific IIB component (EC 2.7.1.69) / PTS system, glucose-specific IIC component (EC 2.7.1.69)
Position: -300 Score: 3.6 Sequence: ATTTGTTAAAAATCGCAAAAAA Position: -180 Score: 3.9 Sequence: AAATGTGATTCCGATCACCGGC Locus tag: EAM_1294 Name: sdaC Funciton: Serine transporter
	EAM_1294	sdaC	Serine transporter
Position: -249 Score: 4.4 Sequence: AAGTGTGATTTTTGTCACTGTT Position: -190 Score: 3.6 Sequence: TAATGAGATTGTGATCCACTTA Locus tag: EAM_1168 Name: sdhC Funciton: Succinate dehydrogenase cytochrome b-556 subunit Locus tag: EAM_1169 Name: sdhD Funciton: Succinate dehydrogenase hydrophobic membrane anchor protein Locus tag: EAM_1170 Name: sdhA Funciton: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) Locus tag: EAM_1171 Name: sdhB Funciton: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
	EAM_1168	sdhC	Succinate dehydrogenase cytochrome b-556 subunit
	EAM_1169	sdhD	Succinate dehydrogenase hydrophobic membrane anchor protein
	EAM_1170	sdhA	Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
	EAM_1171	sdhB	Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
Position: -128 Score: 5.3 Sequence: AATTGTTATCTGCTTCACATTA Locus tag: EAM_0744 Name: araT Funciton: putative permease of the Na+:galactoside symporter family Locus tag: EAM_0743 Name: abfA Funciton: Alpha-L-arabinofuranosidase II precursor (EC 3.2.1.55)
	EAM_0744	araT	putative permease of the Na+:galactoside symporter family
	EAM_0743	abfA	Alpha-L-arabinofuranosidase II precursor (EC 3.2.1.55)
Position: -156 Score: 3.8 Sequence: TGATGTGAGTTGTCTCGCTTTG Locus tag: EAM_0469 Name: CKO_03591 Funciton: hypothetical protein Locus tag: EAM_0470 Name: CKO_03590 Funciton: putative cytoplasmic protein Locus tag: EAM_0471 Name: CKO_03589 Funciton: putative cytoplasmic protein Locus tag: EAM_0472 Name: CKO_03588 Funciton: putative inner membrane protein Locus tag: EAM_0473 Name: CKO_03587 Funciton: putative inner membrane protein Locus tag: EAM_0474 Name: CKO_03586 Funciton: dihydroorotase Locus tag: EAM_0475 Name: CKO_03585 Funciton: hypothetical protein Locus tag: EAM_0476 Name: CKO_03584 Funciton: hypothetical protein
	EAM_0469	CKO_03591	hypothetical protein
	EAM_0470	CKO_03590	putative cytoplasmic protein
	EAM_0471	CKO_03589	putative cytoplasmic protein
	EAM_0472	CKO_03588	putative inner membrane protein
	EAM_0473	CKO_03587	putative inner membrane protein
	EAM_0474	CKO_03586	dihydroorotase
	EAM_0475	CKO_03585	hypothetical protein
	EAM_0476	CKO_03584	hypothetical protein
Position: -218 Score: 5.3 Sequence: ATTTGTGATAAAAATCACACTT Locus tag: EAM_2589 Name: tsx Funciton: Nucleoside-specific channel-forming protein Tsx precursor
	EAM_2589	tsx	Nucleoside-specific channel-forming protein Tsx precursor
Position: -143 Score: 4.6 Sequence: AATTGCGACTTGTATCACCTTT Position: -90 Score: 4 Sequence: ATTAAGGATGTTCATCACATAA Locus tag: EAM_0200 Name: udp Funciton: Uridine phosphorylase (EC 2.4.2.3)
	EAM_0200	udp	Uridine phosphorylase (EC 2.4.2.3)
Position: -92 Score: 4.3 Sequence: TATTTTGATATATAGCGAATTT Locus tag: EAM_1217 Name: ybhK Funciton: hypothetical protein
	EAM_1217	ybhK	hypothetical protein
Position: -158 Score: 3.8 Sequence: AAAGATGATGCAGATCATCAAT Locus tag: EAM_1899 Name: ychE Funciton: putative channel protein
	EAM_1899	ychE	putative channel protein
Position: -97 Score: 3.9 Sequence: AAATGTGATCGCTGACTCATCA Locus tag: EAM_1581 Name: ychH Funciton: membrane protein
	EAM_1581	ychH	membrane protein
Position: -145 Score: 3.9 Sequence: AAATGTTATTTTGTTATCATCT Locus tag: EAM_1665 Name: ydhD Funciton: hypothetical protein
	EAM_1665	ydhD	hypothetical protein
Position: -137 Score: 5.2 Sequence: AATGGTGATCTGCATCACAATT Locus tag: EAM_1930 Name: msrB Funciton: methionine sulfoxide reductase B Locus tag: EAM_1929 Name: b1777 Funciton: conserved hypothetical protein
	EAM_1930	msrB	methionine sulfoxide reductase B
	EAM_1929	b1777	conserved hypothetical protein
Position: -177 Score: 3.6 Sequence: AAATGAGCATTACTTCTCAAAA Locus tag: EAM_2233 Name: yejG Funciton: hypothetical protein
	EAM_2233	yejG	hypothetical protein
Position: -44 Score: 4 Sequence: TTGTGTGTTTTTTTTAAAATTT Locus tag: EAM_2300 Name: yfbV Funciton: putative cytoplasmic protein
	EAM_2300	yfbV	putative cytoplasmic protein
Position: -33 Score: 3.7 Sequence: TTAATTTATTGAATTCATATAT Locus tag: EAM_2384 Name: yfeR Funciton: transcriptional regulator, LysR family
	EAM_2384	yfeR	transcriptional regulator, LysR family
Position: -83 Score: 5.2 Sequence: AAATGTGATTTCAATCACGATT Locus tag: EAM_2617 Name: raiA Funciton: stationary phase translation inhibitor and ribosome stability factor
	EAM_2617	raiA	stationary phase translation inhibitor and ribosome stability factor
Position: -238 Score: 4.5 Sequence: ATTAGTGATAAACTTCACATCA Locus tag: EAM_1104 Name: ygbI Funciton: Hypothetical transcriptional regulator ygbI
	EAM_1104	ygbI	Hypothetical transcriptional regulator ygbI
Position: -90 Score: 4.4 Sequence: TGATGTGAAGTTTATCACTAAT Locus tag: EAM_1106 Name: ygbJ Funciton: D-beta-hydroxybutyrate dehydrogenase (EC 1.1.1.30) Locus tag: EAM_1107 Name: ygbK Funciton: hypothetical protein
	EAM_1106	ygbJ	D-beta-hydroxybutyrate dehydrogenase (EC 1.1.1.30)
	EAM_1107	ygbK	hypothetical protein
Position: -38 Score: 3.6 Sequence: GATTTTTACGCAGATCGCAATT Locus tag: EAM_3109 Name: mtgA Funciton: monofunctional biosynthetic peptidoglycan transglycosylase
	EAM_3109	mtgA	monofunctional biosynthetic peptidoglycan transglycosylase
Position: -134 Score: 3.6 Sequence: AAATATGCCGTATTGAACATTA Locus tag: EAM_3376 Name: yhjE Funciton: Inner membrane metabolite transport protein YhjE
	EAM_3376	yhjE	Inner membrane metabolite transport protein YhjE
Position: -143 Score: 4.9 Sequence: TTATGTGCTGTAAATCACATTC Locus tag: EAM_1710 Name: mlc Funciton: ROK family transcriptional regulatory protein
	EAM_1710	mlc	ROK family transcriptional regulatory protein
Position: -258 Score: 4.1 Sequence: TAATTTGATTATCATCAAGCAT Locus tag: EAM_2679 Name: rpoS Funciton: RNA polymerase sigma factor RpoS
	EAM_2679	rpoS	RNA polymerase sigma factor RpoS
Position: -174 Score: 4.6 Sequence: ACATGTGATGAAGATCAAACTT Locus tag: EAM_2465 Name: guaB Funciton: inosine-5'-monophosphate dehydrogenase Locus tag: EAM_2464 Name: guaA Funciton: bifunctional GMP synthase/glutamine amidotransferase protein
	EAM_2465	guaB	inosine-5'-monophosphate dehydrogenase
	EAM_2464	guaA	bifunctional GMP synthase/glutamine amidotransferase protein
Position: -223 Score: 3.9 Sequence: ATTGATGATCTGCATCATCTTT Locus tag: EAM_1900 Name: adhE Funciton: Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
	EAM_1900	adhE	Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
Position: -110 Score: 3.4 Sequence: GGCTGTGAGGTTTCTCACGTAG Locus tag: EAM_2208 Name: galS Funciton: Mgl repressor and galactose ultrainduction factor GalS, HTH-type transcriptional regulator
	EAM_2208	galS	Mgl repressor and galactose ultrainduction factor GalS, HTH-type transcriptional regulator
Position: -213 Score: 3.2 Sequence: AATAGCGATTTAAGGCAAACTC Locus tag: EAM_0995 Name: hupB Funciton: HU, DNA-binding transcriptional regulator, beta subunit
	EAM_0995	hupB	HU, DNA-binding transcriptional regulator, beta subunit
Position: -121 Score: 3.5 Sequence: AATAGTGAATAAAAATACAATA Locus tag: EAM_0138 Name: argB Funciton: Acetylglutamate kinase (EC 2.7.2.8) Locus tag: EAM_0139 Name: argG Funciton: Argininosuccinate synthase (EC 6.3.4.5) Locus tag: EAM_0140 Name: argH Funciton: Argininosuccinate lyase (EC 4.3.2.1)
	EAM_0138	argB	Acetylglutamate kinase (EC 2.7.2.8)
	EAM_0139	argG	Argininosuccinate synthase (EC 6.3.4.5)
	EAM_0140	argH	Argininosuccinate lyase (EC 4.3.2.1)
Position: -171 Score: 3.9 Sequence: GTGTGTGATGCCGTTAACACAG Locus tag: EAM_3285 Name: ugpB Funciton: Glycerol-3-phosphate ABC transporter, periplasmic glycerol-3-phosphate-binding protein (TC 3.A.1.1.3) Locus tag: EAM_3284 Name: ugpA Funciton: SN-glycerol-3-phosphate transport system permease protein UgpA (TC 3.A.1.1.3) Locus tag: EAM_3283 Name: ugpE Funciton: SN-glycerol-3-phosphate transport system permease protein UgpE (TC 3.A.1.1.3) Locus tag: EAM_3282 Name: ugpC Funciton: SN-glycerol-3-phosphate transport ATP-binding protein UgpC (TC 3.A.1.1.3) Locus tag: EAM_3281 Name: ugpQ Funciton: Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46)
	EAM_3285	ugpB	Glycerol-3-phosphate ABC transporter, periplasmic glycerol-3-phosphate-binding protein (TC 3.A.1.1.3)
	EAM_3284	ugpA	SN-glycerol-3-phosphate transport system permease protein UgpA (TC 3.A.1.1.3)
	EAM_3283	ugpE	SN-glycerol-3-phosphate transport system permease protein UgpE (TC 3.A.1.1.3)
	EAM_3282	ugpC	SN-glycerol-3-phosphate transport ATP-binding protein UgpC (TC 3.A.1.1.3)
	EAM_3281	ugpQ	Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46)
Position: -229 Score: 3.3 Sequence: CATTGCGAATATCTTTACACTT Position: -210 Score: 3.9 Sequence: CTTCGTGACTCATGTCACTAAA Position: -166 Score: 4.8 Sequence: TTAAGTGACCCGCATCACACTT Position: -95 Score: 3.2 Sequence: CGTTTTGATCGTGATCCCTCAA Position: -34 Score: 3.5 Sequence: ACATGAGATTTGCATCATTAAT Locus tag: EAM_3416 Name: mtlA Funciton: PTS system, mannitol-specific IIC component (EC 2.7.1.69) / PTS system, mannitol-specific IIB component (EC 2.7.1.69) / PTS system, mannitol-specific IIA component (EC 2.7.1.69) Locus tag: EAM_3417 Name: mtlD Funciton: Mannitol-1-phosphate 5-dehydrogenase (EC 1.1.1.17) Locus tag: EAM_3418 Name: mtlR Funciton: Mannitol operon repressor
	EAM_3416	mtlA	PTS system, mannitol-specific IIC component (EC 2.7.1.69) / PTS system, mannitol-specific IIB component (EC 2.7.1.69) / PTS system, mannitol-specific IIA component (EC 2.7.1.69)
	EAM_3417	mtlD	Mannitol-1-phosphate 5-dehydrogenase (EC 1.1.1.17)
	EAM_3418	mtlR	Mannitol operon repressor

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Crp in Erwinia amylovora ATCC 49946

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --