Regulog TreR - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Trehalose utilization |
| Effector: | Trehalose-6-phosphate |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - GntR/Others
- By effector - Trehalose-6-phosphate
- By pathway - Trehalose utilization
| Genome | Genes | Operons |
|---|---|---|
| Bacillus subtilis subsp. subtilis str. 168 | 3 | 1 |
| Bacillus amyloliquefaciens FZB42 | 3 | 1 |
| Bacillus pumilus SAFR-032 | 3 | 1 |
| Bacillus licheniformis DSM 13 | 3 | 1 |
| Anoxybacillus flavithermus WK1 | 3 | 1 |
| Geobacillus kaustophilus HTA426 | 3 | 1 |
| Bacillus cereus ATCC 14579 | 2 | 1 |
| Bacillus halodurans C-125 | 3 | 2 |
| Bacillus clausii KSM-K16 | 3 | 2 |
| Oceanobacillus iheyensis HTE831 | ||
| Paenibacillus sp. JDR-2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| treP |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -45 score = 6.85142 sequence = TAAGTTGTATATACAAGTTA Site: position = -77 score = 4.73743 sequence = CTACCTGTATATACAGGAAT Gene: BSU07800: PTS system, trehalose-specific IIB component (EC 2.7.1.69) / PTS system, trehalose-specific IIC component (EC 2.7.1.69) |
*
Bacillus amyloliquefaciens FZB42 Site: position = -56 score = 6.77471 sequence = AAACATGTATATACAAGTTT Site: position = -89 score = 5.16592 sequence = CGACATGTATATACATCATT Gene: RBAM_007970: PTS system, trehalose-specific IIB component (EC 2.7.1.69) / PTS system, trehalose-specific IIC component (EC 2.7.1.69) |
*
Bacillus pumilus SAFR-032 Site: position = -63 score = 6.77471 sequence = AAACATGTATATACAAGTTT Site: position = -95 score = 4.98658 sequence = CTACATGTATATACAAATAT Gene: BPUM_0728: PTS system, trehalose-specific IIB component (EC 2.7.1.69) / PTS system, trehalose-specific IIC component (EC 2.7.1.69) |
*
Bacillus licheniformis DSM 13 Site: position = -43 score = 6.65239 sequence = TAACATGTATATACAGGTTA Site: position = -75 score = 5.099 sequence = CTACTTGTATATACAGGAAT Gene: BLi00796: PTS system, trehalose-specific IIB component (EC 2.7.1.69) / PTS system, trehalose-specific IIC component (EC 2.7.1.69) |
*
Anoxybacillus flavithermus WK1 Site: position = -99 score = 6.99874 sequence = CAACTTGTATATACAAGTTA Site: position = -61 score = 6.44146 sequence = CGACTTGTATATACAAGTTA Gene: Aflv_1441: PTS system, trehalose-specific IIB component (EC 2.7.1.69) / PTS system, trehalose-specific IIC component (EC 2.7.1.69) |
*
Geobacillus kaustophilus HTA426 Site: position = -95 score = 5.94824 sequence = CAGGTTGTATATACAAGTTT Site: position = -124 score = 6.82013 sequence = AAACTTGTATATACAAGATA Gene: GK1747: PTS system, trehalose-specific IIB component (EC 2.7.1.69) / PTS system, trehalose-specific IIC component (EC 2.7.1.69) |
*
Bacillus cereus ATCC 14579 Site: position = -91 score = 5.66256 sequence = AAACTCGTATATACGAGTGT Site: position = -67 score = 6.45909 sequence = TAACTTATATATACGAGTTA Gene: BC0631: PTS system, trehalose-specific IIB component (EC 2.7.1.69) / PTS system, trehalose-specific IIC component (EC 2.7.1.69) |
*
Bacillus halodurans C-125 Site: position = -102 score = 6.93975 sequence = TAACTTGTATATACAAGATA Site: position = -65 score = 5.17917 sequence = GGACTTGTATATACAAATTC Gene: BH2216: PTS system, trehalose-specific IIB component (EC 2.7.1.69) / PTS system, trehalose-specific IIC component (EC 2.7.1.69) |
*
Bacillus clausii KSM-K16 Site: position = -115 score = 5.29716 sequence = GTATTTGTATATACAGGTTA Site: position = -75 score = 4.99092 sequence = ATATTTGTATATACAAATTC Gene: ABC1263: PTS system, trehalose-specific IIB component (EC 2.7.1.69) / PTS system, trehalose-specific IIC component (EC 2.7.1.69) |
|
|
PTS system, trehalose-specific IIB component (EC 2.7.1.69) / PTS system, trehalose-specific IIC component (EC 2.7.1.69) |
| treA |
Gene: BSU07810: Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
Gene: RBAM_007980: Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
Gene: BPUM_0729: Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
Gene: BLi00797: Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
Gene: Aflv_1440: Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
Gene: GK1746: Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
Gene: BC0632: Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
*
Bacillus halodurans C-125 Site: position = -100 score = 6.99874 sequence = CAACTTGTATATACAAGTTA Gene: BH0872: Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
*
Bacillus clausii KSM-K16 Site: position = -66 score = 6.08728 sequence = GAACTTGTATATACAAGTGT Gene: ABC1264: Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
|
|
Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
| treR |
Gene: BSU07820: Trehalose operon transcriptional repressor, GntR family |
Gene: RBAM_007990: Trehalose operon transcriptional repressor, GntR family |
Gene: BPUM_0730: Trehalose operon transcriptional repressor, GntR family |
Gene: BLi00798: Trehalose operon transcriptional repressor, GntR family |
Gene: Aflv_1439: Trehalose operon transcriptional repressor, GntR family |
Gene: GK1745: Trehalose operon transcriptional repressor, GntR family |
Gene: BC0630: Trehalose operon transcriptional repressor, GntR family |
Gene: BH0873: Trehalose operon transcriptional repressor, GntR family |
Gene: ABC1265: Trehalose operon transcriptional repressor, GntR family |
|
|
Trehalose operon transcriptional repressor, GntR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |