Regulog ManR - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | BglG |
| Regulation mode: | activator |
| Biological process: | Mannose utilization |
| Effector: | ManP, mannose-specific enzyme IIBCA PTS component; HPr, phosphocarrier protein |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - BglG
- By effector - ManP, mannose-specific enzyme IIBCA PTS component
- By effector - HPr, phosphocarrier protein
- By pathway - Mannose utilization
| Genome | Genes | Operons |
|---|---|---|
| Bacillus subtilis subsp. subtilis str. 168 | 3 | 2 |
| Bacillus amyloliquefaciens FZB42 | 3 | 2 |
| Bacillus pumilus SAFR-032 | ||
| Bacillus licheniformis DSM 13 | 2 | 1 |
| Anoxybacillus flavithermus WK1 | ||
| Geobacillus kaustophilus HTA426 | ||
| Bacillus cereus ATCC 14579 | ||
| Bacillus halodurans C-125 | ||
| Bacillus clausii KSM-K16 | ||
| Oceanobacillus iheyensis HTE831 | ||
| Paenibacillus sp. JDR-2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| manP |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -100 score = 7.66946 sequence = TATTACCGGAACCTATGGTAAAA Gene: BSU12010: PTS system, mannose-specific IIB component (EC 2.7.1.69) / PTS system, mannose-specific IIC component (EC 2.7.1.69) / PTS system, mannose-specific IIA component (EC 2.7.1.69) |
*
Bacillus amyloliquefaciens FZB42 Site: position = -101 score = 7.66946 sequence = TATTTCCGGAACTTATGGTAAAA Gene: RBAM_024200: PTS system, mannose-specific IIB component (EC 2.7.1.69) / PTS system, mannose-specific IIC component (EC 2.7.1.69) / PTS system, mannose-specific IIA component (EC 2.7.1.69) |
|
*
Bacillus licheniformis DSM 13 Site: position = -105 score = 7.32502 sequence = TTTTTCCGGAGCCTGCGGTAAAA Gene: BLi02108: PTS system, mannose-specific IIB component (EC 2.7.1.69) / PTS system, mannose-specific IIC component (EC 2.7.1.69) / PTS system, mannose-specific IIA component (EC 2.7.1.69) |
|
|
|
|
|
|
|
PTS system, mannose-specific IIB component (EC 2.7.1.69) / PTS system, mannose-specific IIC component (EC 2.7.1.69) / PTS system, mannose-specific IIA component (EC 2.7.1.69) |
| manA |
Gene: BSU12020: Mannose-6-phosphate isomerase (EC 5.3.1.8) |
Gene: RBAM_024190: Mannose-6-phosphate isomerase (EC 5.3.1.8) |
|
Gene: BLi02107: Mannose-6-phosphate isomerase (EC 5.3.1.8) |
|
|
|
|
|
|
|
Mannose-6-phosphate isomerase (EC 5.3.1.8) |
| CRON 2. | ||||||||||||
| manR |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -136 score = 6.6326 sequence = TTTTTCCGGAAGCTTCGGTAAAA Gene: BSU12000: transcriptional antiterminator |
*
Bacillus amyloliquefaciens FZB42 Site: position = -139 score = 7.43983 sequence = TTTTTCCGGAACCTGCGGTAAAA Gene: RBAM_024210: Transcription antiterminator, BglG family / PTS system, mannitol (Cryptic)-specific IIA component( EC:2.7.1.69 ) |
|
Gene: BLi02111: Activator of the mannose operon (transcriptional antiterminator), BglG family |
|
|
|
|
|
|
|
transcriptional antiterminator |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |