Regulog BgrT5 - Bifidobacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | |
| Biological process: | Cellobiose utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - TetR
- By pathway - Cellobiose utilization
| Genome | Genes | Operons |
|---|---|---|
| Bifidobacterium adolescentis ATCC 15703 | 1 | 1 |
| Bifidobacterium angulatum DSM 20098 | ||
| Bifidobacterium animalis subsp. lactis AD011 | ||
| Bifidobacterium bifidum NCIMB 41171 | ||
| Bifidobacterium breve DSM 20213 | ||
| Bifidobacterium dentium Bd1 | 1 | 1 |
| Bifidobacterium gallicum DSM 20093 | ||
| Bifidobacterium longum NCC2705 | ||
| Bifidobacterium longum subsp. infantis ATCC 15697 | ||
| Gardnerella vaginalis 409-05 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| cbpA |
*
Bifidobacterium adolescentis ATCC 15703 Site: position = -107 score = 7.05255 sequence = TTATTTATAAGTTTATAAACAA Gene: BAD_0439: Cellobiose phosphorylase (EC 2.4.1.20) |
|
Gene: BLA_0623: Cellobiose phosphorylase (EC 2.4.1.20) |
|
|
*
Bifidobacterium dentium Bd1 Site: position = -146 score = 7.65887 sequence = TTATTTATAAAGTTATAAATAA Gene: BDP_2127: Cellobiose phosphorylase (EC 2.4.1.20) |
|
|
|
|
Cellobiose phosphorylase (EC 2.4.1.20) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |