Regulog GosR2 - Bifidobacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Galactooligosaccharide utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - LacI
- By pathway - Galactooligosaccharide utilization
| Genome | Genes | Operons |
|---|---|---|
| Bifidobacterium longum subsp. infantis ATCC 15697 | 6 | 3 |
| Bifidobacterium adolescentis ATCC 15703 | ||
| Bifidobacterium angulatum DSM 20098 | ||
| Bifidobacterium animalis subsp. lactis AD011 | ||
| Bifidobacterium bifidum NCIMB 41171 | ||
| Bifidobacterium breve DSM 20213 | ||
| Bifidobacterium dentium Bd1 | ||
| Bifidobacterium gallicum DSM 20093 | ||
| Bifidobacterium longum NCC2705 | ||
| Gardnerella vaginalis 409-05 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| Blon_2414 |
*
Bifidobacterium longum subsp. infantis ATCC 15697 Site: position = -99 score = 6.28081 sequence = AGATTAAATCGGTTTAAAAC Gene: Blon_2414: Galactooligosaccharide ABC transporter, substrate-binding component |
|
|
|
|
|
|
|
|
|
Galactooligosaccharide ABC transporter, substrate-binding component |
| Blon_2413 |
Gene: Blon_2413: Galactooligosaccharide ABC transporter, permease component |
|
|
|
|
|
|
|
|
|
Galactooligosaccharide ABC transporter, permease component |
| Blon_2412 |
Gene: Blon_2412: Galactooligosaccharide ABC transporter, permease component |
|
|
|
|
|
|
|
|
|
Galactooligosaccharide ABC transporter, permease component |
| xylD |
Gene: Blon_2411: endo-1,4-beta-xylanase |
|
|
|
|
|
Gene: BDP_0131: endo-1,4-beta-xylanase |
|
|
|
endo-1,4-beta-xylanase |
| CRON 2. | |||||||||||
| gosR2 |
*
Bifidobacterium longum subsp. infantis ATCC 15697 Site: position = -130 score = 6.4829 sequence = GCGTTAAACCGATTTAATTC Gene: Blon_2415: Transcriptional regulator of galactooligosaccharide utilization, LacI family |
|
|
|
|
|
|
|
|
|
Transcriptional regulator of galactooligosaccharide utilization, LacI family |
| CRON 3. | |||||||||||
| lacZ5 |
*
Bifidobacterium longum subsp. infantis ATCC 15697 Site: position = -165 score = 6.4829 sequence = GAATTAAATCGGTTTAACGC Gene: Blon_2416: Beta-galactosidase (EC 3.2.1.23) |
|
|
|
|
|
Gene: BDP_2145: Beta-galactosidase (EC 3.2.1.23) |
|
|
|
Beta-galactosidase (EC 3.2.1.23) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |