Regulog NagR - Clostridia-2
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | N-acetylglucosamine utilization |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Clostridia-2
- By TF family - GntR/Others
- By pathway - N-acetylglucosamine utilization
| Genome | Genes | Operons |
|---|---|---|
| Clostridium bartlettii DSM 16795 | ||
| Clostridium difficile 630 | 3 | 1 |
| Clostridium hiranonis DSM 13275 | 3 | 1 |
| Genes | Function | |||
|---|---|---|---|---|
| CRON 1. | ||||
| nagR |
|
*
Clostridium difficile 630 Site: position = -36 score = 5.77364 sequence = AAATTGGTATATACCATATC Site: position = -52 score = 6.062 sequence = TAATTGGTATATACCAAAAT Gene: CD1009: Transcriptional regulator of N-Acetylglucosamine utilization, GntR family |
*
Clostridium hiranonis DSM 13275 Site: position = -36 score = 5.88548 sequence = TAATTGGTATAGACCAAAAT Gene: CLOHIR_01904: Transcriptional regulator of N-Acetylglucosamine utilization, GntR family |
Transcriptional regulator of N-Acetylglucosamine utilization, GntR family |
| nagA |
|
Gene: CD1010: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25) |
Gene: CLOHIR_01905: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25) |
N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25) |
| nagB |
|
Gene: CD1011: Glucosamine-6-phosphate deaminase (EC 3.5.99.6) |
Gene: CLOHIR_01906: Glucosamine-6-phosphate deaminase (EC 3.5.99.6) |
Glucosamine-6-phosphate deaminase (EC 3.5.99.6) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |