Regulog SdaR - Enterococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | SdaR |
| Regulation mode: | activator |
| Biological process: | Glycerate utilization |
| Effector: | D-glycerate |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterococcaceae
- By trascription factor - SdaR
- By TF family - SdaR
- By effector - D-glycerate
- By pathway - Glycerate utilization
| Genome | Genes | Operons |
|---|---|---|
| Enterococcus faecalis V583 | 3 | 2 |
| Enterococcus faecium DO |
| Genes | Function | ||
|---|---|---|---|
| CRON 1. | |||
| grtP |
*
Enterococcus faecalis V583 Site: position = -100 score = 5.38569 sequence = TTTTGTGCATTTGAACAATA Gene: EF2647: D-glycerate transporter, GntP family |
|
D-glycerate transporter, GntP family |
| garK |
Gene: EF2646: Glycerate kinase (EC 2.7.1.31) |
|
Glycerate kinase (EC 2.7.1.31) |
| CRON 2. | |||
| sdaR |
*
Enterococcus faecalis V583 Site: position = -153 score = 4.65749 sequence = CCTTGTGACTAAGAACTAAC Gene: EF2645: Glycerate utilization transcriptional regulator SdaR, SdaR family |
|
Glycerate utilization transcriptional regulator SdaR, SdaR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |