Regulog QorR - Nocardiaceae
| Regulator type: | Transcription factor |
| Regulator family: | HxlR |
| Regulation mode: | repressor |
| Biological process: | Energy metabolism |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Nocardiaceae
- By trascription factor - QorR
- By TF family - HxlR
- By pathway - Energy metabolism
| Genome | Genes | Operons |
|---|---|---|
| Nocardia farcinica IFM 10152 | ||
| Rhodococcus erythropolis PR4 | 2 | 2 |
| Rhodococcus opacus B4 | 2 | 2 |
| Rhodococcus sp. RHA1 | 2 | 2 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| qorB |
|
*
Rhodococcus erythropolis PR4 Site: position = -70 score = 6.68421 sequence = GCACTTACGAAAAATAAGTGC Gene: RER_15420: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2) |
*
Rhodococcus opacus B4 Site: position = -78 score = 6.57116 sequence = GCACTTACGAAAAATTAGTGC Gene: ROP_18550: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2) |
*
Rhodococcus sp. RHA1 Site: position = -79 score = 6.57116 sequence = GCACTTACGAAAAATTAGTGC Gene: RHA1_ro02137: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2) |
Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2) |
| CRON 2. | |||||
| qorR |
|
*
Rhodococcus erythropolis PR4 Site: position = -69 score = 6.68421 sequence = GCACTTATTTTTCGTAAGTGC Gene: RER_15410: Redox-sensing transcriptional regulator QorR, HxlR family |
*
Rhodococcus opacus B4 Site: position = -66 score = 6.57116 sequence = GCACTAATTTTTCGTAAGTGC Gene: ROP_18560: Redox-sensing transcriptional regulator QorR, HxlR family |
*
Rhodococcus sp. RHA1 Site: position = -66 score = 6.57116 sequence = GCACTAATTTTTCGTAAGTGC Gene: RHA1_ro02138: Redox-sensing transcriptional regulator QorR, HxlR family |
Redox-sensing transcriptional regulator QorR, HxlR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |