Regulog NrtR - Shewanellaceae
| Regulator type: | Transcription factor |
| Regulator family: | NrtR |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | Adenosine diphosphate ribose |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By trascription factor - NrtR
- By TF family - NrtR
- By effector - Adenosine diphosphate ribose
- By pathway - NAD biosynthesis
| Genome | Genes | Operons |
|---|---|---|
| Shewanella oneidensis MR-1 | 2 | 1 |
| Shewanella putrefaciens CN-32 | 2 | 1 |
| Shewanella sp W3-18-1 | 2 | 1 |
| Shewanella sp ANA-3 | ||
| Shewanella sp MR-4 | ||
| Shewanella sp MR-7 | ||
| Shewanella baltica OS155 | ||
| Shewanella denitrificans OS217 | ||
| Shewanella frigidimarina NCIMB 400 | ||
| Shewanella amazonensis SB2B | ||
| Shewanella loihica PV-4 | ||
| Shewanella pealeana ATCC 700345 | ||
| Shewanella halifaxensis HAW-EB4 | ||
| Shewanella piezotolerans WP3 | ||
| Shewanella sediminis HAW-EB3 | ||
| Shewanella woodyi ATCC 51908 |
| Genes | Function | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||||
| prs |
*
Shewanella oneidensis MR-1 Site: position = -170 score = 6.93343 sequence = ATAGTGTCTAAAAGACACTAT Site: position = -84 score = 6.58032 sequence = ATAATGTCTTTAAGACACTAT Gene: SO_1980: Ribose-phosphate pyrophosphokinase (EC 2.7.6.1) |
*
Shewanella putrefaciens CN-32 Site: position = -170 score = 6.71333 sequence = ATAGTGTCTAAAGGACACTAT Site: position = -84 score = 6.58032 sequence = ATAATGTCTTTAAGACACTAT Gene: Sputcn32_2327: Ribose-phosphate pyrophosphokinase (EC 2.7.6.1) |
*
Shewanella sp W3-18-1 Site: position = -170 score = 6.71333 sequence = ATAGTGTCTAAAGGACACTAT Site: position = -84 score = 6.58032 sequence = ATAATGTCTTTAAGACACTAT Gene: Sputw3181_1681: Ribose-phosphate pyrophosphokinase (EC 2.7.6.1) |
|
|
|
|
|
|
|
|
|
|
|
|
|
Ribose-phosphate pyrophosphokinase (EC 2.7.6.1) |
| nadV |
Gene: SO_1981: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12) |
Gene: Sputcn32_2326: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12) |
Gene: Sputw3181_1682: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12) |
|
|
|
|
|
|
|
|
|
|
|
|
|
Nicotinamide phosphoribosyltransferase (EC 2.4.2.12) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |