Regulog ModE - Alcaligenaceae
| Regulator type: | Transcription factor |
| Regulator family: | ModE |
| Regulation mode: | repressor (activator) |
| Biological process: | Molybdopterin biosynthesis |
| Effector: | Molybdate |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - ModE
- By taxonomy - Alcaligenaceae
- By TF family - ModE
- By effector - Molybdate
- By pathway - Molybdopterin biosynthesis
| Genome | Genes | Operons |
|---|---|---|
| Bordetella avium 197N | 3 | 1 |
| Bordetella bronchiseptica RB50 | 3 | 1 |
| Bordetella petrii DSM 12804 | 3 | 1 |
| Genes | Function | |||
|---|---|---|---|---|
| CRON 1. | ||||
| modA |
*
Bordetella avium 197N Site: position = -65 score = 6.79221 sequence = ATCGTTATATACAAGGCTATATTTCGAT Gene: BAV2468: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
*
Bordetella bronchiseptica RB50 Site: position = -95 score = 7.10819 sequence = TTCGTTATATATTCCACTACATAACGCT Gene: BB0825: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
*
Bordetella petrii DSM 12804 Site: position = -51 score = 6.98369 sequence = TTCGTTATATAGTTCAGTTTATAGCGAG Gene: Bpet0724: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
| modB |
Gene: BAV2467: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
Gene: BB0824: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
Gene: Bpet0725: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
| modC |
Gene: BAV2466: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
Gene: BB0823: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
Gene: Bpet0726: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |