Regulog Svir_39240 - Frankineae/Propionibacterineae/Pseudonocardiaceae
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug resistance; Multidrug efflux |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Frankineae/Propionibacterineae/Pseudonocardiaceae
- By TF family - GntR/Others
- By pathway - Multidrug resistance
- By pathway - Multidrug efflux
| Genome | Genes | Operons |
|---|---|---|
| Actinosynnema mirum DSM 43827 | ||
| Saccharomonospora viridis DSM 43017 | 3 | 1 |
| Saccharopolyspora erythraea NRRL 2338 | ||
| Acidothermus cellulolyticus 11B | ||
| Frankia sp. CcI3 | ||
| Frankia sp. EAN1pec | ||
| Nakamurella multipartita DSM 44233 | 3 | 1 |
| Nocardioides sp. JS614 | ||
| Propionibacterium acnes KPA171202 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| Svir_39240 |
|
*
Saccharomonospora viridis DSM 43017 Site: position = -45 score = 5.71115 sequence = CATGGTTACCTACATGACTAATGAACCCAG Gene: Svir_39240: Transcriptional regulator, GntR family |
|
|
|
|
*
Nakamurella multipartita DSM 44233 Site: position = -43 score = 5.79386 sequence = ATGGGTACATTAGTGGAGTAACTAACCACT Gene: Namu_4757: Transcriptional regulator, GntR family |
|
|
Transcriptional regulator, GntR family |
| lp_2743 |
|
Gene: Svir_39230: ABC-type multidrug transport system, ATPase component |
|
|
|
|
Gene: Namu_4756: ABC-type multidrug transport system, ATPase component |
|
|
ABC-type multidrug transport system, ATPase component |
| lp_2744 |
|
Gene: Svir_39220: ABC-type multidrug transport system, permease component |
|
|
|
|
Gene: Namu_4755: ABC-type multidrug transport system, permease component |
|
|
ABC-type multidrug transport system, permease component |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |