Regulog CD1503 - Clostridia-2

Properties
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes				Function

CRON 1.
CD1503	* Clostridium bartlettii DSM 16795 Site: position = -45 score = 7.30821 sequence = TATGGTTAATTACTTGAGTAACTAACTATA Gene: CLOBAR_01627: Transcriptional regulator, GntR family	* Clostridium difficile 630 Site: position = -47 score = 6.84754 sequence = TATAGTTAATTAGTTGAGTAACTAACTAAT Gene: CD1503: Transcriptional regulator, GntR family	* Clostridium hiranonis DSM 13275 Site: position = -68 score = 6.32758 sequence = AGGAGTTAGTTACTTGACTAACTAACCAAT Gene: CLOHIR_01288: Transcriptional regulator, GntR family	Transcriptional regulator, GntR family
lp_2743	Clostridium bartlettii DSM 16795 Gene: CLOBAR_01628: ABC-type multidrug transport system, ATPase component	Clostridium difficile 630 Gene: CD1504: ABC-type multidrug transport system, ATPase component	Clostridium hiranonis DSM 13275 Gene: CLOHIR_01289: ABC-type multidrug transport system, ATPase component	ABC-type multidrug transport system, ATPase component
lp_2744	Clostridium bartlettii DSM 16795 Gene: CLOBAR_01629: ABC-type multidrug transport system, permease component	Clostridium difficile 630 Gene: CD1505: ABC-type multidrug transport system, permease component	Clostridium hiranonis DSM 13275 Gene: CLOHIR_01290: ABC-type multidrug transport system, permease component	ABC-type multidrug transport system, permease component

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --