Regulog Sde_3525 - Oceanospirillales/Alteromonadales

Properties
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Phylum:	Proteobacteria/Gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Alcanivorax borkumensis SK2
Chromohalobacter salexigens DSM 3043
Hahella chejuensis KCTC 2396
Marinomonas sp. MWYL1
Oceanobacter sp. RED65
Oceanospirillum sp. MED92
Reinekea sp. MED297
Cellvibrio japonicus Ueda107
Marinobacter aqueolei
Marinobacter sp. ELB17
Saccharophagus degradans 2-40	3	1
Teredinibacter turnerae T7901

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes													Function

CRON 1.
Sde_3525	Alcanivorax borkumensis SK2	Chromohalobacter salexigens DSM 3043	Hahella chejuensis KCTC 2396	Marinomonas sp. MWYL1	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Reinekea sp. MED297	Cellvibrio japonicus Ueda107	Marinobacter aqueolei	Marinobacter sp. ELB17	* Saccharophagus degradans 2-40 Site: position = -69 score = 5.04109 sequence = CACTGTATTACTTGACCAACACACTA Gene: Sde_3525: Transcriptional regulator, GntR family	Teredinibacter turnerae T7901	Transcriptional regulator, GntR family
XAC1547	Alcanivorax borkumensis SK2	Chromohalobacter salexigens DSM 3043	Hahella chejuensis KCTC 2396	Marinomonas sp. MWYL1	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Reinekea sp. MED297	Cellvibrio japonicus Ueda107	Marinobacter aqueolei	Marinobacter sp. ELB17	Saccharophagus degradans 2-40 Gene: Sde_3524: ABC transporter, ATP-binding protein	Teredinibacter turnerae T7901	ABC transporter, ATP-binding protein
XAC1546	Alcanivorax borkumensis SK2	Chromohalobacter salexigens DSM 3043	Hahella chejuensis KCTC 2396	Marinomonas sp. MWYL1	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Reinekea sp. MED297	Cellvibrio japonicus Ueda107	Marinobacter aqueolei	Marinobacter sp. ELB17	Saccharophagus degradans 2-40 Gene: Sde_3523: ABC transporter, permease protein	Teredinibacter turnerae T7901	ABC transporter, permease protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --