Regulog CD0652 - Clostridia-2

Member of regulog collections
- By taxonomy - Clostridia-2
- By TF family - GntR/Others
- By pathway - Multidrug resistance
- By pathway - Multidrug efflux
Genome | Genes | Operons |
---|---|---|
Clostridium bartlettii DSM 16795 | ||
Clostridium difficile 630 | 6 | 2 |
Clostridium hiranonis DSM 13275 | 3 | 1 |
Genes | Function | |||
---|---|---|---|---|
CRON 1. | ||||
CD0652 |
|
*2
Clostridium difficile 630 Site: position = -48 score = 7.36232 sequence = TTTATATAATGTGTATATACTATATATACAATTTAAGGA Gene: CD2023: Transcriptional regulator, GntR family Site: position = -60 score = 5.24172 sequence = AGTGTATAGTGTGTATATAATAACATCACACTGAAAATG Gene: CD0652: Transcriptional regulator, GntR family |
*
Clostridium hiranonis DSM 13275 Site: position = -104 score = 6.50176 sequence = TGTATATAGTGTATATACAGTTGACAGAATTTATATACA Site: position = -115 score = 6.6032 sequence = TTAAAAAATTGTGTATATAGTGTATATACAGTTGACAGA Site: position = -63 score = 6.98616 sequence = GTTATTATGTGTATATAGATAATATATACAGTATATACA Gene: CLOHIR_00432: Transcriptional regulator, GntR family |
Transcriptional regulator, GntR family |
BH0652 |
|
2
Clostridium difficile 630 Gene: CD2024: ABC-type multidrug transport system, ATPase component Gene: CD0653: ABC-type multidrug transport system, ATPase component |
Gene: CLOHIR_00433: ABC-type multidrug transport system, ATPase component |
ABC-type multidrug transport system, ATPase component |
BH0653 |
|
2
Clostridium difficile 630 Gene: CD0654: ABC-type multidrug transport system, permease component Gene: CD2025: ABC-type multidrug transport system, permease component |
Gene: CLOHIR_00434: ABC-type multidrug transport system, permease component |
ABC-type multidrug transport system, permease component |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |