Regulog FruR2 - Various betaproteobacteria
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Fructose utilization |
| Effector: | Fructose-1-phosphate |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Various betaproteobacteria
- By TF family - LacI
- By effector - Fructose-1-phosphate
- By pathway - Fructose utilization
| Genome | Genes | Operons |
|---|---|---|
| Methylobacillus flagellatus KT | ||
| Methylophilales bacterium HTCC2181 | ||
| Methylotenera mobilis JLW8 | ||
| Nitrosomonas europaea ATCC 19718 | ||
| Nitrosospira multiformis ATCC 25196 | ||
| Thiobacillus denitrificans | ||
| Azoarcus sp. EbN1 | ||
| Dechloromonas aromatica RCB | ||
| Thauera sp. MZ1T | ||
| Neisseria meningitidis MC58 | ||
| Laribacter hongkongensis HLHK9 | ||
| Chromobacterium violaceum ATCC 12472 | 4 | 2 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| fruB |
|
|
|
|
|
|
|
|
|
|
|
*
Chromobacterium violaceum ATCC 12472 Site: position = -186 score = 4.39398 sequence = CTGAGAAATCGTTTTCAATT Site: position = -53 score = 4.8896 sequence = AAATGTAATCGTTTTCAATG Gene: CV3052: PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) |
PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) |
| fruK |
|
|
|
|
|
|
|
|
|
|
|
Gene: CV3053: 1-phosphofructokinase (EC 2.7.1.56) |
1-phosphofructokinase (EC 2.7.1.56) |
| fruA |
|
|
|
|
|
|
|
|
|
|
|
Gene: CV3054: PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69) |
PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69) |
| CRON 2. | |||||||||||||
| fruR2 |
|
|
|
|
|
|
|
|
|
|
|
*
Chromobacterium violaceum ATCC 12472 Site: position = -155 score = 4.8896 sequence = CATTGAAAACGATTACATTT Site: position = -22 score = 4.39398 sequence = AATTGAAAACGATTTCTCAG Gene: CV3051: Transcriptional regulator for fructose utilization, LacI family |
Transcriptional regulator for fructose utilization, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |